>DTH_21_1_Mno length=7082;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; GGTTCCGTTTATTTTACCGATTCGAGTTTTGCTACAGTAAAAAGTTCTCAGAAATAACTATATTTAATTTTTTACTACAA TAAAAACTTTTCTCATAAAGTCACATCTTAATTCGAATTAAAAACTCAAATCAATTCGTTATTGATTTTTTGGGCCAAAA AAAAAAAAGGTTTGTGCTTATTGCTTCGCTTTTAACGCGCATAAATTATAAACTTTGAAAGCGTAGAATGTGGATGTTGA ATAGGGTTAAATCTAAGACTATCCACTCTGGTGTTGCGCATAGATACAGCTCATGATCTGCCCACTATTCATATGCATTT TTGTTGTTCTCTTGTCTTGTGATCTAATAATGAATAAAATGTTTGAATCTGACCCATTTTTCTTTTTTAACTCCCCACTA TGCCAGTCTGATATAGAGTTGGAAAGCTTGCGAAGACCAAGGCCTACCTTATAGGTCAGTTTGCCTCTTTGGAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACAAGTCCATTTCTTGATTATTAATTAAATTTGTTTAATTTTACTGCAAC CGAGTCCGACCAAGAACATTCTCTATCTCTTGGTTTTTTCTACCAGGTCTCCCACCTTTACGCTTTTTTGTTTCCATTGG GTACCCGTTAACCTGCTTTGCATTCGGTCAAAAGTAGCGTATAATGTTGAAATTCTTAAATCGATGTGGGGTCCGCTATA CACGTATGTCTACCGTGCACCTAAAGGAGAAGTATTGTATAATTTGTATTAATAGATAAGCTTTAAATTCCTTAACTTTC TGGTAAACCAAATGGCGATAGTAGCATATGATGTGACGAGGGCGTTAAGTACAAATTTAATGCTACATCACGGAAGTTTT TGACAAAATAAGAAAGATATGTAGAAAGGGTAATAAGACAAATACACATTGTTTTCGTTTTTATCTTTGCATATACAGCA GCCCCAATCGCTATCTAAAAGAAATCTAGGAACCCTTATTATGTCGGCTATTTTTTCCCCTTCTCACAAAGTGGTAAAAG ATCAATCATTTTTGTAGGTAGCTCATTCTTTTTTTTTTTTTTTTTTTTTTTTGGGATCTTGATGAGCAACTCTCGTAATT TGGATCAATTATACCTTAGTTTATTGAATAGTTAGATTAATAGTACTGTTTACGCTTCGAGCACACAATTCTAAACCTTC TACTATTATTGAATTAATTTAACTCTAGTCTAAGCAAGCTGTTTCACTAAAGATATTACTAATAAAATACTATATACAAC AAAATCCAATAATGTATGCTCCTGTTTGTTTCGACCACTCAAAAATCTTAATTCAAAATTCAAATTGGTGTTTGGGAGAG AAAAGTTCAATAACAATTTAATTCATTAACAATGATTTAAAGGCAATTTAAATTGTTGATTTTAGAATTCACATTCCCTT TAAATTATAACAATTTGAATTATCGTCAACAGTCTAATAACTTTATATTTTACTTTTTCTTTTTTTTTTAATTTCAATCT TAAAAATGTCATATCTTATTCGTTTTTATTCCAATTGAGATGATTTTTTTTAATGTGCTCATAATGAAGAGATGAATAAA TTCTCACACATATTGTGTATTTTTTAATGTAATTTATAATGATGTTTTATAAAATTTATTATAAAACTCTAATGACAGTT TTTAACACTTTATTCAAATGCAATTTAAATTTTATTCTTAATTTAAATTATAATTTATTTATATATCAATAACAGTTTAG ATTACAATTTAAATCACTACTGTTTCGATTTTATAATTTTAATAAAAAAAATTTAAACTTTCACAATTTGAATTATTGAA CTAAAATAAGTCCTTACAAGTTTTTCCCACCGGTGTTTGCAGGGACCAATTCCCGTCGGGATGTGATCCACCAATCTTGG TTCCGCAGATTGTTCCGGTCCATTAATCAGTGGGTCCCAACATACAGTCTCTTGTACTTGCCAAAACTTTGCTGGACAAA CTTCCGAAAGGACACGAGAAATAACAAGATTCATTGGTGCCTCAAAATTGAATAAAACGACCACCGAAGACCCAAAAATA AAAATCATTCTTATTAAAAAAAAAAAAAAAAACCCACAAATCACAAAAGCGCGTAACCCGTAGTCAGCGTCTTACACCTA CCGCCACCAACGCACCCGCCCAACCTCTCAAATCACACCGCCCCCAATTCGCGTTCACACTTGCGCCCTTCAGGTTTTTC TTCCATATTTTAATACACACACAACACACACAAAAAGTCAAACAATGGCTCGGCCATCCATCATCCATCATGTATCCCCA CCAATTTTTTTCAAAAGGTGTTGACTCATTGCATCCTTGCCATGTGTACTTTTGATCTTTTAATATGTATCGGTATTACC CTAAAAAATAGGGACCTTATCTGATATATTAATGCATGAGTAAGTTAAATTCTTTTTCTCTTAAATCTGTATTCAAAAAC ATAAAAATCAAAATTTATTTAAATTTAATGATTAAAAAAATTTAACATGTCGGTATATCAACGTATTAAAGAATCTCCAT AAAAGATATCGACAAAAATGATTCAAACATTTGCCCTAATAGTATATTTTCTTTCTATCACCTTTAGCCTTTTTTTTTTT TTTTTTTGCGTTTTTAGGCATCAAAAAAACAAATCCCATCCCTGATATTCATTCCAATTTCCATCTCAATCATTAACATT GCAAACCCAAAAAGAAAGGAAAAATATCAATGCACATTGCAATTGGAAATGCATTTACATTATTAAAGGTTAGATTGACT TGGGGAACTAAATTGACAATAATGAGGCAAAGAATTTCATTAATACACAGTAAAACTATAAAAGTCCCCCCGACTGTATG AATGTACGAGAATGCAAAGTATACACGCATACATTGGAAACAAACCACAAAAATCATCCCCGATTTCTCTTACTTTTAAG ATACCGTTCACACCTTTGCTTCCCCTTTCACACATATAATCCGCCGTACTAATTCCTACAGTCCAAACCCATACTTTTCC CCTCTCTCTCTCTCTCTCTATATCGAGTTTGCGTTAACTTCTTTCCTAGTTATTGTTCCTCAATCGTCGGCTCTGCTTTT CGTTTTCCTCGTTTTCTTTCCTTCTATTTCTTTTCCTGTTTTTTTTTTCCTTCCTTCTCATATATGAAACACATATACCC TTCTTCCCCAGACCCCGAAGACCTCTCCCAAATCTACAGACTCTTGCTCCAAACCTCAGCGCTCCACCAAATGAGCGAAA ATGGCAAGCGAAGAAGAAACGACGACGACGACGAAAACGGTGAAAACGACGATTCCTCGGACAAGGAAGCCAAGAAGAAG AGCCTCAAGGGAATAATCACTTCCCTATTACTACTCGACGAACAAGAAAAGCACGAGAGCCAAGAGCTCGACCGAGCCTC AAACGACGAGAAATCCCTCCTCGATGATATCCACAAGAAGAAGACCAAGACCATGCTTGATTACTACGCCAATTTCCAGG ATTTGAACTCGGAAATCGAGGAATCCAGCCGCACAAAGCGCAAAAAATCAAGGACGGTTTCCGCCGCTGCGGCGGCGGCG GCGGTAATTTCGGCGGAGGACGGGTCCGACAAGGCCTCCACCTCCGCCGCCACGTCAGCAGTCCACCAGCGGAGACTGTG GGTGAAGGACCGGTCGAATGCGTGGTGGGACGAGTGCAACAGCCCGGATTTTCCGGAGGAGGAATTCAGGAAGGCCTTTA GGATGGGGAAATCCACGTTTGACATGATATGCGAAGAGCTGAATTCTGTCATAGCGAAAGAGGATACGACACTAAGAAAC GCTATTCCGGTTAGGCAGAGAGTCGCCGTTTGCCTTTGGAGATTGGCCACGGGGGACCCACTTCGCCTTGTGTCGAAACG CTTCGGATTAGGCATATCAACGTGCCACAAGTTGGTCCTTGAGGTTTGCTCGGCCATTAGGACTGTCCTAATGCCGAAAT ACTTGCAGTGGCCGGAGGAGAGTGCTTTGAGGAAGATCAAGGACGCATTTGAGTCTGTATCTGGGATTCCCAATGTTGTG GGGTCTATGTACACTACTCATATTCCTATCATTGCTCCTAAGATTAGTGTGGCTGCTTATTTCAATAAACGACATACGGA GAGGAACCAGAAGACGTCGTATTCGATAACGGTGCAAGGCGTGGTTGATCCTAGAGGAGTTTTCACCGATGTGTGCATTG GTTGGCCTGGCTCAATGCCTGATGATCAGGTGCTTGAGAAGTCTGCCCTTTACCAAAGGGCTAATGGGGGTCTCTTGAAA GGGGTTTGGATTGTTGGGACTTCAGGATATCCGCTAATGGATTGGGTTTTGGTGCCTTATACGCAGCAGAATTTGACTTG GACTCAACATGCGTTTAATGAGAAGATTGGGGAGATTCAAAAGGTTGCTAAAGATGCGTTTGCCAGGCTTAAAGGGAGGT GGTCTTGCCTGCAGAGGCGAACCGAGGTCAAACTCCAGGACCTGCCTGTGGTCCTTGGGGCTTGCTGTGTTTTGCACAAC ATTTGTGAGTTGAAGAATGAGGAGATGGATCCCCAACATGAGTTTGAGCTTTTCGACGATGAGATGGTCCCGGATGTCAT TTTGAGGTCCGAGAGCTCGAGATTGGCGAGGGATACGATTGCGCATAATCTCTTGCACCATGGCCTTGCAGGCACTTCTT TTCTCTAGTGCTTTTAATGATTTGTGTAATTTTTTCTGCTCTATATTGTGATTCTTTTGATTATTGGCTTGTTATAGTTA CTTCTGTTGTTAGAAAGATTATACACTCATTTGTACTGAAGGGGTCCTGTAAAAGATGAACCTACCCCTTCCCTCAGATT AATGGTTGTAATCTTTATCATAGGATTGACTCAAGTTATACTTCACGGTTACTAGAAAACGTGCCCCGACCTAGGTTTCC TTCAATTCTATTAACAAAACAAGAGATGAATAAAAAAAAAATGAAAAATAAGCTTTATTCGTTTGTTACTTGTAGCAGTT TTTCCTCTGACGATATAAATTAGTGAATAACAGTTTCCAGTTTTCTATGATGGATAATTGGATTTGGTTGTACTTGTCCT CTTTCTAAGTTGAATTTCCATCTCAAACAAATATTTATCAGTTGTATTTTATCACTATGGGGGTTGTTGGTTTCTGTGTC TTTTGAATCCTTTAAAGGCCCAATCTTGCACTTTATTTGACATCGTTTATCGATTTAAAATAATCATATCTCAATTCAAA TCGAAAAATTACCAAAGTTTGTCCGTAGTTTTATATTTATATTTATATGCAATTTCTGATGTTTAACTTGAGAGTGGAAT TTGAATGGTTAAACTAAATCAGGAGCAATAGTTTAAGACTTCTAGAGATTCCTTTCACACTAAGCTAAACCCAGCTTCTT TTTTTAATTTTTTTTTTTTAAAAAAGGACAATGTCGTTAATCATTACAATTTTAATACTCTTAACAAGTTCCTGCCACAG TCGTAGGCATAATTCATGCCAAATGAGAGATGGGTTGAGTTAGGCATCGAGCACTAATTTAAATGAATGACTTTATTGAT GACTTGCTTAAGCCATAAGCCTACCACTGCGTACTGTTTTAGTTACAAACAACTTTATATAATAACCTTAAAAGTCCATC TGTCGGAATTATATTTTGTACTGATTTGTGACCATTATCTGATATTAGAGATCATACCACCATAATTCCCATTGTTCATG TCTCGGCAAACAACCACTATTAAAGACAATGACCTGTCTTAAATAATGAGTGTTTGCAAAATAAAAACTTGCTATCTATC CACCATAAAAGAAGGGATTTTTTTTATGGAGGAGCCCAATAAGTGCTCCATTGGTGGAGCACTGTTTTTTTACTGTTAGA TTACTTTTTTAACGGTCAGATATGTAGTAAGAGCAGTTATGTACGGCGTGTTGTAAATTTTTAATACGGACATACGCATA TCTCATCGTTAAAAAATTAATTCAACGGTTAAAAAAACAGTGTTAGAACACTCATTGGGATTCCACCATAAAAAATCTCA CACGCTTCTACACAGTTTCTCATTCTCTTCTTTGGAATATTTTCGTGCATAGATAGATAATCAGTTCAATAATCTTCATG GCGGTGCATATTTTACACCTAGAAATCTTGCCCTTGACGTGCCCATCTGATTTCCAATAATTCAATTCAAACCCCATATC AGATTTTCAAAGAAAAATTTCCAATGAAGCAATAGTAAAATCATTTTCCATGAGCCATGACTTACAAGGGAAACATGCTC AAGCCAGCAAAACCTCTCCGCGCATGCATATACGACATTCTAAAAACTGGCATTAGCTCAACCTGTCTGGTCATCTTTCA TCAAGAATTCAGCAGAAAGGCGATTAGTTTTCCCATCAATAAGTCCCAAAGAAAACTGGCAATTAGAGGAGTATTAACTC TGATTCTAGCAGCTTCAATCTTGTTACGCTTGCGGTCGTATTTTTAGTTACAAACTTAAAAAAAATGAAAGTTTAAGAGT TCGTTTAGTTCGTTGATTCGAATTTTTAATTCAAATTGAGATGTGACTTTATGTGAAAACTTTTTACTGTAGTAAAAAAG TTAGATGTGATTATTTATGAGAGCTTTTTACTATAGCAAACTCAAATTCTAAACTCGAATCAATGAAATGAACGGGTCCT AAGAATACAAGAAGGAAAAGAAAAACAAAACACTTAAGCCTAAAAAGTATTGAGCGGCGATCTCATTAAGCACTTCAAGG TATCTGCATTATTGATGTATATCTCATTAATTGTCTGACTGGAGTGAATTGGAAAAAGTATTGAGCCGCAATCTCATAAA TTGAATGAGATTCTTTATAGATCTCTGTATAAGAATTAGGCTTCATTCATTTCACGGATTTGAGTTTAAAATTTGAGTTT TATTACAGTAAAAAGCTCTCAAAAACAGTTTCATCTAACTTTTTTACTACAGTAAAAAGCTCTCACATAAAAGTCACATC TCAACTCGAATTAAAACTCGAATCAACGAACTAAACGAGCCC