>DTH_20_1_Mno length=2411;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; TTTTTTTTAAAAAAATAATAAAATAAAATCAAAGAAAAGTCAAGTCACCGTCAAAAACCCCAAATACGCCGCGTTCACAT TTGCGCACACGCTTCTCTCGCTCGCCATGCCATATATATCTCCCAACGCCAACTCTTTTCTCCTCCATCTCAATTTCTTC GATTCACTTCCATACCAAGAAACACAAAAACAAAATCAAAGAGAAAAAAAGAGAATAAAAGGAAAAAACCCAGTTCGTTC ACACTTCTGTTGGATCATTTTCATGGAAATTAGCCCCGTCCTATCGTTTCTTAACCAGGAAGACTTTTCTCACTTCTTCA GCTCGTTCCCAGATATGGACGACGACTCTTTTGATGTGAATTTGAACGACGGAAACGACTCAAGAAAGCGGCGAAGAAAG GACGAAGAGCAAGAATACGAGATTAACAAGAATCTCGACCAACATTACTCCCAATTGAACGATTTGGATCAGTCCCTAAC CAAACGAGCTCGCCGATCGACCTCTACCGCCGTGGTCCTCGCCGCGGCAACGGCGGAGAGTAATACGGTGCCGTCGAGCT CGGGGAATGGGGCACCGGTCGGGCACCAGCGACGGCTGTGGGTGAAGGACCGGTCGAAGGACTGGTGGGACCAGCACAAC CACCCGGACTTTCCCGAGGAGGAGTTCAAGAGGGAGTTCAGGATGAGCAAAGCGACCTTCGAGATGATCTGCAATGAGCT CGACTCATCTGTAATGAAGAAGAACACGATGCTTCGGGAGGCGATTCCGGTTCGCCAGAGAGTCGCGGTCTGCATTTGGA GGTTGGCCACCGGCGAGCCTCTCCGCCTCGTCTCGAAGCGTTTCGGGCTTGGGATTTCGACCTGCCACAAGCTCGTCTTG GAGGTCTGCTCGGCGATCAGAACAGTTCTGATGCCGAAATTCCTCCAATGGCCCGACGAGCAGAGGATGAAGACGATCAA GGAGGAGTTCGAATCAATCTCCGGGATCAAGAACGTCGCCGGGGCAATGTACACCACCCACGTCCCGATCATCGCGCCGA AGATAAGCGTGGCGGCGTATTTCAACAAGAGACACACCGAGAGGAACCAGAAAACCTCGTACTCGATCACGGTCCAAGGC GTCGTCGATCCCAAAGGAGTTTTCACCGACGTCTGTATCGGGTGGCCCGGCTCAATGCCGGATGATCAAGTGCTCGAAAA GTCGGCGCTTTTCCAGCGGGCGAGTCGCGGGCTTCTGAGGGATGTTTGGATCGTGGGAAACTCTGGATTTCCGCTTCTCG ACTGGGTTTTGGTCCCGTACACAAGGCAGAATCTGACTTGGGCGCAACACGCTTTCAATGAGAAGGTTGGGGAGGTCCAA AACGTGGCTAAGGAGGCTTTCGCTAAGCTTAAAGGAAGGTGGTCGTGTTTGCAGAAGAGGACTGAGGTTAAGCTTCAGGA CTTGCCTGTGGTTCTTGGGGCTTGCTGTGTTTTGCACAACATTTGTGAGATGAGGAATGAGGAGATTGATCCGACGGCCA AGTTTGAGCTTTTTGATGATGAGATGGTGGCTGAGAATAGCTTAAGGTCTGCCACCTCTGTGCAGAAGAGAGATCAGATT GCGCATAACTTGTTGCACCATGGCCTTGCTGGCACTTCTTTTCTATCTTGATGATTGCTTATTACTTGTTAGTTAAAGGA AAGTTTTTTTTTTCCCTTTTAGCTATAATTCTTTTGGGTTATAGATACAGAATAAGAGTAAGATTCAATTTTTTTGTAGG TTGGTTTGAGTTTCTTCTGTACAAGATTGTATTTGATTCTAGCAATTAGCAATTGTAAGAATGAAATGTATACTTTTTTA CACTTGTATGAATGATCTGTCTTGTTTATGATTTTTTGCGTTACGGTTGATTATTGTTGTTGTTGGGTTTAGTTAGAAGA AGTTTAATTTATGTATTTAAAATTATTTTTATTTTATGTATATTTTTTATAAAAAAAATACTATAAAAAATTATTAATCA TAATTCAAAATTAATAAGGAATATAGAAAATAAACTCTAATTTTGTTTAGTTTATTGCCATGATGGGGTTGAAGAATCTA AAAGGCCCCAATTTGCATTTGACAAGCGTGTGTAGTGTCGCAGGGAACATCAGAGACACCATTTTTCAACGCTTATGAAA ATCCTTTTTGCAGTGTATCAGGGAACATCAGAGACACCATTTTTCAACGCTTATGAAAATCCTTTTTGCAGTGTATCAGG GAACATCAGAGACACCATTTTTCAACGCTTATGAAAATCCTTTTTGCAGCCGTAATTTTGGCGTAATTTTGGCCGTTATC TTACTCATTTAAGTTTTTAATTTTAATTTTTTACAAAAGATTATAATTAATTTTTTTATAGTAACAAAATTAATAAAATG AACCAAGTCTT