>DTH_2_1_Mno length=2530;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; TTTTTTTTTTTTTGGGGTTGAACACGTTGATTACTACTTTAGTTAGTTTTGCTGTTTCTGTGCGTGTGATAATGGCTATC AAACAAATTACAACTGTTCCTCCTTTTTCTTTTGCTTTTCAAGAATAATGAAGACAAATAAGAGGGATTTGCTGTCAAGA TTTTGGATGTACATAAATCATCTTTTTTCCTTATTTTAATTTAATTTTTTATGCCTAGGTTTTGGATGGATAGCATTCCT AGGTTTTGGACGTACATAAATAATGATTCTAGTACTCTAGTTTTTTTTTTCTTTTTTTCTTATTATTTGATTCTTGTGTT ATGTTTATTGTTGTTCATTTTTATAATATACAATATAATACTAAATCTAATTTTATATGTTGATAATGTAGAGTACTCAT GTCTAGACTTTTAGTACGAAAGAAGAGTGTGGTTGTAGTAATAAAAGAGATAGTTATGATGTTACAAATGATTATGGTTG TGTGTGCTGCTATGTGTACCTATATTTCTATTTATTATGAACGAAGGATACGAAGCCCAAAGATGGTTATAAGGTCACTT GTATGATTTGATTTACGAGAGTGATATCAAGTGTGTGGCACAATTAAGAATGGATAGAGAAACGTTTAGAAGATTATGCA AGCTTCTATGTGAGAAAGGAGGTTTGACAAGCACAAGAAATGTAATTGTTGAGGAGATGCTTGCAATGTTTTTGCACATC CTAGCACATCATGTTAAGAATAGGGTGATTAGTTTCAATTTTAAGAGATCCGGAAGAACGATTAGTAAATGTTTCCACAA GTGTTTAAAAGCAATTATTCGGTGTCAAAAAGAATTTTGGAAAAACCCAGAACCAGTTTTGGAGAACTCAACTGACCCTA AATGGAAGTGGTTTATGGTATGTGTTCTCTTTTTTTATTATTTTGAAAAAAATTGTTTTAAATTATATTTGTGTTCTTAA AATTTTATGCTTCTTTTTCATAATAATATAGAATTATTTGGGAGCATTGGATGGAACATATGTAAGAGATCGTGTGCCAG AGGCAGACAAATCAAGATATAGAACAAGGAAAAATGAGATTGCTACTAATGTCTTAGGAGTTTATTCACAAGACATGCAA TTTATATATGTCCTACCGGGATGGGAAGGTTCAACGCACGATATGCATGTGTTAAGGGACACAGTGACTAGAAGAAATGG TTTAAAGGTTCCTCATGGTAATTTTATACAACAACACTAATTTTTTTTTTCATGACATTATATTGTTTGTATATTATCTA TTTGCTCATTGTTTAATATTGTTACTTTTTATATTGGTTGATAGGTTATTACTACTTGGTAGATGGTGGCTATAGTAATG GGACCGGTTTTCTTGCACCATTTAGAGGACAACGTTACCATTTAAGTGAGTTTAACAATAGAAACCAACCAACTTCGGCG GAAGAGTTTTTCAACATGAAGCACTCGAGTGCTAGGAATGTTATTGAGCGGTGCTTTGGATTATTGAAAATGCGATGGGC TATACTAAAAAGTCATTGCTTTTATGACATAAAAATACAACAACAAATAATTTATGTATGTTGTATGTTACATAACTTTA TTCGAAGAGAAATGGCTTATGACCCTATGGACATTGTGTACGATAATGATCCAGCACAACAATTGAACAATGAGACGGAG TTTATTGATTCCATTGAAACATCTACCGAGTGAACTACATGGAGACAAAATTTGGCACAAGAGATGTGGATTGAATGGCG AGCAAGTAGAGAATAGGATTAAGGATTGACTTGTTTGAGAATTTTTTTTTTTTTATCATTTTTACGCATTAAGCACATTA TATTGGCATGCTATTAATGTTACATACTATTGTTATGGAATTCTTCAATTTCAAGATTTATGCAACTTTGTTATATGGTT TACTTATATTTTATACATGACTTGTTCATTTTTTGTTTAGAATGAGTTCCATTCCAGCTTCTTCAACTCAAAGAGGACGA GGTCAAAACAAGCATTATTGGACAACACAACAGGATGACGCACTGATAGAGGCATTGTCTGAATTGAGTCAAAACGCAAT GTGGCGGGCTGATTGTGGTTTTAAAAATGGGTATTTGCTTCAATTGGAGACAATGATGGAGGCCAAATTACCAGGTTGTG CCATCAAAGCATCTCCTCATATTGAATCTCGTGTGAAATGGTTTAAGAAAAAATATTGTGCAATGACAGATATGTTGTCT CTTAGTGGGTTTAGATTGGACAATGATAAGATGATATTACAATGTGAAAAAAATGTGTATGATAAGTATGTTAAGGTACG TGTAATAAACTTTTTTCACAATGGTTGTTACTTGGTTATTATTTAGTGAATTAACAAATGTTATTTAACTTGTTTAACAG AAACGAAAAGATGATGCTGGTTTATATGGAAAACCTTTTCCTCATTATTACACTTTGGGTGAAATTTATGGACGTGATCG AGCTATAGGCATTGGTGCTGGAAATGCAGATGATGATGAGGAAGAGGTCC >DTH_2_2_Mno length=2529;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; AGAACAGCAAAGCTAGTACAGCTTTTCATCCTCTATTTTTGTCTTCTAGCATTTTTTTCCTTCTAGAGTACTAGAACAGC AAAAACAATGGCATGTTTACGAGTACTATAACATGTAGTAATGCTTCTAGGTTTTTTATCCCTCTTTATTTCTTTAAATT CTTATATTTATTTTATTTTAGGAATTTCTACTATAAGATTAGAAAATTGAAACTATCAATAATTTTTATCTCTCTTTTTT TCTCGTGATTCTAGTACTCTAGTTTTTTATTTTTTTTATTTTTTATAATTTGATTCTTGTGTTATGCCTATTGTTGTTCA TTTTTATAATATACAATGTGGTACTAAATATAATTTTATATGTTGATAATGTAGAGTAATCATGTCTAGACTTCTAGTAC GAAAGAAGAGAGTGGTTGTAGTGATAAAAGAGATAGTTATGATGTTACAAATGATTATGGTTGTGTGTGCTGCTATGTGT ACCTATGTTTCTTTTTATTATGAGCGAATGATACAAAGTCCAAAGATGGTTATAAGGGTTTATCAACAATTAGGTCATTT GTATGATTTGGTTTACGAGAGTGATATCAAGTGTGTGGCACAATTAAGAATGGATAGAGAAACATTTAGAAGATTATGCA AGCTTCTATGCGAGAAAGGAGGTTTGACAAGCACAAGAAATGTATCTATTGAGGAGATGCTTGCAATGTTTTTGCACATC CTAGCACATCATGTTAAGAACAGGGTGATTAGTTTCAATTTTAAGAGATCCGAAAGAACGATTAGTAAATGTTTCCACGA GTGTTTAAAAGTAATTATTCGGTGTCAAAAGGAATTTTGGAAAAATCCAGAACCAGTTTTGGAGAACTCAACTGACCCTA AATGGAAGTGGTTTAAGGTATGTGTTCTCTTTTTTTATCATTTTGAAAAAATTTGTTTTGAATTATATTTGTGTTCTTAA AATTTTATGCTTCTTTTTCATAACAATGTAGAATTGTTTGGGAGCATTGGATGGAACGTATGTAAGAGTTCGTGTGCCGG AGGCAGACAAATGAAGATATAGAACAAGGAAAAATGAGATTGCTACTAATGTTTTAGGAGTTTGTTCACAAGACATGCAA TTTATATATGTCCTACCGGGATGGGAAGGTTCAACGCACGATATGCGTGTGTTAAGGGACGCAGTGACTAGAAGAAATGG TTTAAAGGTTCCTAACGGTAATTTTATACAACAACACTAAATTTTTTTTAATGACATTATATTGTTTGTATATTATCTAT TTGCTCATTGTTTAATATTGTTACTTTTTATATTGGTTGATAGGTTATTACTACTTAGTAGATGGTGACTATAGTAATGG GACCGGTTTTCTTGCACCATTTAGAGGACAACGTTACCATTTAAGTGAGTTTAACAATAGAAACCAACCAACTTCGGTGG AAGAGTTTTTCAACATGAAGCACTCAAGTGCTGGGAATGTTATTGAGCGGTGCTTTGGATTATTGAAAATGCGATGGGCT ATACTAAAAACTCATTGCTTTTATGACATAAAAATACAACGATAAATAATTTCTGTCTGTTGTATGTTACATAACTTTAT TCGAAGAGAAATGGCTTATGACCCTATGGACATTGTGTACGATAATGATCCAGCACAACAATTGAACAATGAGACGGAGT TTATCGATTCCATCGAGACATCTACCAAGTGGACTACATGGAGACAAAATTTGGCACAAGAGATGTGGACTGAATGGCGA GCAAGTAGAGAATAGGATTAAGGATTGACTTGTTTGAGAATATTTTTATTATCATTTTTGTGCATTGAGCACGTTATATT GGCATGTTATTAATGTTACATACTATTGTTATGGAATTCTTCAATTTCAAGATTTATACAACTTTGTTATATGGTTTAGT TATATTTTATACATGACTTGTTCATTTCTTGTTTAGAATGAGTTCCATTCCAGCTTCTTCAACTTAAAGAGGACAAGGTC TAAACAAGCATTATTAGACAACACAACAGGATGACACACTAATAGAGGCATTGTTCGAATTGAGTCAAAATGCGATGTGG CAGGCTGATTGTGGTTTTAAAAATGGGTATTTACTTCAATTGGAGACTATGATGGGACCAAATTACCAGGTTGTGCCATC AAAGCATCTCCTCATATTGAATCTCGTGTGAAATGGTTTAAGCAAAAATATTGTGCAATGATAGATATGTTGTCTCTTAG TGGGTTAAGATTGGACAATGATAAGATGATATTACAATGTGAAAAAAATGTGTATGATGAGTATGTTAAGGTACGTGTAA TAAACTTTTTTCACAATGGTTGATACTTGGTTATTATTTAGTGAATTAACAAATGTTATTTAACTTGTTTAACATAAGCG AAAAGATGCTGCTGGTTTATATGGAAAACCTTTTCCTCATTATTACACTTTGGGTGAAATTTATGGATGTGATCGAGCTA TAGGCATTGGTGCTGGAAATGCAGATGATGATGAGGAAGAGGTCCGCCA >DTH_2_3_Mno length=2529;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; TACTACTATTAATTTTTATCCAGATTCTTTTAATGTTCATTATTGATACTATATAATTTTTGTCCAGATTCTTTTAATGT TCATTATTGATACTATATAATTTTTGTCCAGATTCTTTTAATGTTCATTATCCGTTTGTTTCGTTACTATTATTTTGTGT TATTTCTTACACTACTAACAAAAATAAACTCTTTTTCACTGTCAATAAATTTCAGTGATCCACAATTATTTTTTTTGTGG TGTTTATTTGTTTTATAGTAATATATAGATAATTCCGTATTTTTAGTTAGTATGTTTTATCTTTAATTAGTTTTATGACA TGTTTACTTATCAGGAGTAGGGAATGAGAATTGATATTCGGAATCAACTCTATGTTTACTTATCCATTTATATCTTGGAA TGAGAGTGAAAATGTGTGGGTCCCACACCAATTTAGAATTAAGGAATGAGATTGGCACTCCCCCCACCCCCACTGGATTG CCACTCTCATTCCTGATATTAAATACAAAATTACGAATTTATCCTTAACTTTTCTCCTTTATTTAACTCTCTAGGGTTTA TTTTCCTCTTTCTCTCTCAGTCATTTACCATCTCCTCTTTTCCTCTTCTGCCGGTTCTTCAATTTGCAGGTAGGACATAA ATCATCTTTTATTTTTGTTTTCGGTTTGCTTTTTTTTTTTTTTTTTTTGGTTGAACATGTTGATAATGATTTAAAAGCAC AGGGTGAACATGTTAAGAACAGGGTGATTAGTTTCAATTTTAAGAGATCTGGAAGAACGATTAGTAAATGTTTCCACAGA GTGTTTAAAAGCAATTATTCGGTGTCAAAAAGAATTTTGGAAAAACCCAGAACCAGTTTTGGAGAACTCAACTGACCCTA AATGAAAGTGGTTTAAGGTATGCGTTCTCTTTTTTTATTATTTTGAAAAAATTTGTTTTAAATTATATTTGTGTTCTTAA AATTTTATGCTTCTTTTTCATAATAATGTAGAATTGTTTGGGAGCATTGGATGGAACGTATGTAAGAGTTCGTGTGCCAG AGGCAGACAAATCAAGATATAGAACAAGAAAAAATGAGATTGCTACTAATGTCTTAGGAGTTTGTTTACAAGACATGCAA TTTATATATGTCCTACCGGGATGGGAAGGTTCAACGCACGATATGCGTGTGTTAAGGGACGCAGTGACTAGAAGAAATGG TTTAAAGGTTCCTCACGGTAATTTTATACAACAACACTAAATGTTTTTTAATGACATTATATTGTTTGCATATTATCTAT TTGTTCATTGTTTAATATTGTTACTTTTTATATTGGTTGATAGGTTATTACTACTTGGTAGATGGTGGTTATAGTAATGG GACCAGTTTTCTTGCACCATTTAGAGGATGACGTTACCATTTAAGTGAGTTTAACAATAGAAACCAACCAACTTCGGCGG AAGAGTTTCAACATGAAGCACTTGAGTGCTAGGAATGTTATTGAGCGATGCTTTGGATTATTGAAAATGCGATGGGTTAT ACTAAGAAGTCATTGCTTTTATGACATAAAAATACAGCAATAAATAATTTTTGTATGTTGTATGTTACATAACTTTATTC GAAGAGAAATGGCTTATAACCCTATGGACATTGTGTACGATAATGATCCAGCACAACAATTGAACAATGAGACGGAGTTT ATCGATTCCATTGAAACATCTACCGAGTGTACTACATGGAGACAAAATTTGGCACAAGAGATGTGGACTGAATGGCGAGC AAGTAGAGAATAGGATTAAGGATTGACTTGTTTGACTATATTTTTTTATCATATTTTTTGATTTATGACTTGGAACTTCT TTTTGAAAATTTATGAGTTAAAACCTTAGTTATTTTGTTCTTATTTTATTTCATCATCATATTCTTTTCTTGAAATTGAG TTAAAATTTATTGAGAAAAATAACTTAGATGAATAATTTGGTGAGATTAAAAAAATCTAATTACTAGTTAATTATTCTAA TATTAAGATAGTTAGCATAATATACAATTTTTTTTAAAAGTTTAACGCACAAAAATCTACTAAAAGGGTAGGTAAGTAAA TTTATAACAGTTTATTCTGATTCTGAGTGTAAGTAAACGCATGAATAGGATTGGGATTGATTCCGATTTCAATTCCTGGA ACCTAAGTAAACAGCTTATTTTGACTCCGATTTCTGACTCTGATTCCTGCTCACTCCGATTGATGTCCACTCCGATTACA AATAAGTAAACATGTCCTTAGTGTATGCCAATGATTATTACAACTGGTTTTTACTGTTCAGTGTCATGTTATTTATTCAG ATGTTGCTATGGATATATTTGTGGTTATTTATATTCTGATTTTGGACTATGATTTTGCCTGTATTTTTTACCTAATAATT GTCTAGATATTTTCTTTTTTTTTACTCCTCCTTTCCTTTCTTCTTTACTTACTCTTAACATTTTTGGCTTTCTGGTTACC TGGCTTCATCTTGGCTTATTTAGTGCTTAGTAAGCTATGTCTTTTTCAG >DTH_2_4_Mno length=2529;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; TTTTTTTTGTGTTAAACATGTTGATAATGCTTTAGTTTAGCTAGTTTTGCTGTCAAGGTTTTGATGTTCCTTTCCATGTG CGGTGCATGTGTCCTCTTATAGCTTTTCAGTTTTTTTTCTTATTTTAATTTAATTTTTTATCCATCTTTATTTCTTTAAA CTCTTATATCTATTTTATTTTAGAAATTTCTACTGTAAGATTAGAAAACTAAAACCTTCAATAATTTTTATCCATCTTTA TTTCTCGTGATTCTAGTACTCTAGTTTTTTTTTTCTTTTTTCTTATAATTTGATTCTTGTGTTATGCCTATTGTTGTTCA TTTTTATAATATACAATGTAATACTAAATCTAATTTTATATGTTGATAATGTAGAGTAATCATGTCTAGACTTTTAGTAC GAAAGAAGAGAGTGGTTGTAGTCATAAAAGAGATAGTTATGATGTTACAAATCATTATGGTTGTGTGTGCTGCTATGTGT ACCTATGTTTCTATTTATTACGAATGAAGGATACGAAGTCCAAAGATGGTTATAAGGGTTTATCAACAATTAGGTCACTT GTATGATTTGGTTTATGAGAGTGATATCAAGTGTGTGGCACAATTAAGAATGGATAGAGAAACGTTTAGAAGATTATGCA AGCTTCTATGTGAGAAAGCATGTTTGACAAGCACAAGAAATGTATCTGTTGATGATATGCTTGCAATGTTTTTGCACATC CTAGCACATCATGTTAAGAACAGGGTGATTAGTTTCAATTTTAAGAGATCCGGAAGAACGATTAATAAATGTTTCCACGA GTGTTTAAAAATAATTATTCGGTGTCAAAAAGAATTTTAGAAAAACCCAGAACCAGTTTTGGAGAACTCAACTGACCCTA AATAGAAGTGGTTTAAGGTATGTGTTCTCTTTTTTTATTATTTTGAAAAAATTTGTTTTAAATTGTATTTGTGTTCTTAA AATTTTATGCTTCTTTTTCATAATAATGTAGAATTGTTTGGGAGCATTGGATGGAACGTATGTAAGAGTTCGTGTGCCAG AGGCAGACAAATCAAGATATAGAACAAGGAAAAATGAGATTGCTACTAATGTCCTAGGAGTTTGTTCACAAGACATGCAA TTTATACATGTCCTATCGGGATGGGAAGGTTCAACACACGATATGCGTGTGTTAAGGGACGCAGTGACTAGAAGAAATGG TTTAAAGGTTCCTCACGGTAATTTTATACAACAACACTAAATTTTTTTTAATGACATTATATTGTTTGTATATTATCTAT TTGCTCATTGTTTAATATTGTTACTTTTTATATTGGTTGATAGGTTATTACTACTTGGTAGATGGTGGCTATAGTAATGG GACCGGTTTTCTTGCACCATTTAGAGGACAACGTTACCATTTAAGTGAGTTTAACAATAGAAACTAACCAACTTCGGCGG AAGAGTTTTTCAACATGAAGCACTTGAGTGCTAGGAATGTTATTGAACGGTGCTTTGGATTATTGAAAATGCGATGGGCT ATACTAAGAAGTCATTGCTTTTATGACATAAAAATACAACGACAAATAATTTCTGTATGTTGTATGTTACATAACTTTAT TCGAAGAGAAATGGCTTATGACCCTATGGACATTGTGTACGATAATGATCCAGCACAACAATTAAACAATGAGACATAGT TTATCGATTCCATTGAGACATCTACCGAGTGGACTACATGGAGACAAAATTTGGCACAAGAGATGTGGACTGAATAGCGA GCAAGTAGAGAATAGGATTAAGGATAGACTTGTTTGAGAAATTTTTTTTTTATCATTTTTATGCATTGAGCACGTTATAT TGGCATGTTATTAATGTTACATACTATTGTTATGGAATTCTTCAATTTTAAGATTTTTACAACTTTGTTATATGGTTTAG TTATATTTTATACATGACTTGTTCATTTCTTGTTTAGAATGAGTTCCATTCTAGCTTCTTCAACTCAAAGAGGACGAGGT CAAAACAAGCATTATTGGACAACACAGCAGGATGACGCACAAATAGAGGCATTGTTTGAATTGAGTCAAAACGCAATGTG GCGGGCTGATTGTGGTTTTAAAAATGGGTATTTGCTTCAATTTGACACTATGATGGAGGCCAAATTACTTGGTTGTGCCA TCGAAGCATCTCCTCATATTGAATCTCGTGTGAAATAATTTAAGCAAAAATATTGTACAATGACAGATACGTTGTCTCTT AGTGGGTTTGGATTGGACAATGATAAGATGATATTACAATGTGAAAAAAGTGTGTATGATGAGTATGTTAAGGTACGTGT AATAAACTTTTTTCACAATGGTTGTTACTTGGTTATTATTTAGTGAATTAACAAATATTATTTAACTTGTTTAATAGAAG CAAAAAGATGCTGCTGGTTTATATGGAAAAACTTTTCCTCATTATTACACTTTGGGTGAAATTTATGGACGTGATCGAGC TACAGGCATTGGTGCTGAAAATGCAGATGATGATGAGGAAGAGGTCTGC >DTH_2_5_Mno length=2528;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; TTTTGCTTTAGTTAGTGGGTAAGGAACAGACATGACGCCCAAATAAACGATAATACTGACACATAACATTATCTTAAATT TGACCCAAATGAACAGTAATAGGAGTTTGTTAGCAATGTCAAATACCATCTCCTACACTTAACTAAAATAACAATGGTCA GGGATAGTTGAAAAAATAATTTTAATTGGAACGAGGCCTTCTAAATCAGATAAGCATATGCATAAGAAAAAAAATGTAAA GAGAACAATACCAATGTACTCTAGTTTTTTTTTTCTTTTTTTCTTATAATTTGATTATTGTGTTATGTCTATTGTTGTTC ATTTTTATAATATACAATGTAATACTAAATCTAATTTTATATGTTGATAATGTAGAGTAATCATGTCTAGACTTTTAGTA CGGAAGAAGATAGTGGTTGTAGTGATAAAAGAGAGAGTTATGATGTTACAAATGATTATGGTTGTGTGTGCTGCTATGTG TACCTATATTTCTATTTGTTATGAACGAAGGATATGAAGTCCAAAGATGGTTATAAGGGTTTATCAACAATTAGGTCACT TGTATGATTTGGTTTACGAGAGTGATATCAAGTGTGTGGCACAATTAAGAATGGATAGAGAAACGTTTAGAATTTTATGC AAGCTTCTATGTGAGAAATGAGGTTTGACAAGCACAAGAAATGTATCTGTTGAGGAGATGCTTGCAATGTTTTTGCACAC CCTAGCACATCATGTTAAGAACAGGGTGATTAGTTTCAATTTTAAGAGATCCGGAAGAACGATTAGTAAATGTTTCCATG AGTGTTTAAAAGCAATTATTCGGTGCCAAAAAGAATTTTGAAAAAACCCAGAACCAGTTTTGGAGGACTCAACTAACCCT AAATGGAAGTGGTTTAAGGTATGTGTTTTTTTTATTATTATTTTGAAAAAATTTGTTTTAAATTATATTTGTGTTCTTAA AATTTTATGCTTCTTTTTCATAATAATGTAGAATTGTTTAGGAACATTGGATGGAACGTATGTAAGAGTTCGTGTGCCAG AGGTAGACAAATCAAGATATAGAACAAGGAAAAATGAGATTGCTACTAATGTCTTAGAAGTTTGTTCACAAGACATGCAA TTTATATATGTCCTACTGGGATGGGAAGGTTCAACGCACGATATGCGTGTGTTAAGGGACACAGTGACTAGAAGAAATGG TTTAAAGGTTCCTCGCGGTAATTTTATACAACAACACTAAATTTTTTTAATGACATTATATTGTTTGTATATTATCTATT TGCTCGTTGTTTAATATTGTTACTTTTTATATTCGTTGATAGGTTATTACTACTTGGTAGATGGTAGCTATAGTAATGGG ACCGGTTTTCTTGCACCATTTATAGGACAACGTTACCATTTAAGTGAGTTTAACAATAGAAACCAACTAACTTCGGCGGA AGAGTTTTTCAACATGAAGCACTCGAGTGCTAGGAATATTATTAAGCGGTGCTTTGGATTATTGAAAATGCGATGGGCTA TACTAAGAAGTCATTGCTTTTATGACATAAAAATACAACGACAAATAATTTCTGTATGTTGTATGCTACATAACTTTATT CGAAGAGAAATGGCTTATGACCCTATGGACATTGTGTACGATAATGATCCAGCACAACAATTGAACAATGAGACATAGTT TATCGATTCTATTGAAACATCTACCGAGTGGACTACTTGGAGACAAAATTTGGCACAAGAGATGTGGACTGAATGGCGAG CAAGTAGAGAATAGGATTAACGATTGACTTGTTTGAGAATATTTTTTTATCATTTTTATGCATTAAGCACGTTATATTGG CATGTTATTAATGTTACATACTATTGTTATGAAATTCTTCACTTTCAAGATTTATGCAACTTTGTTATATGGTTTAGTTA TATTTAATACATGACTTGTTCATTTCTTGTTTAGAATGAGTTCCATTCCAGCTTCTTCAACTCAAAGAGGACGAGGTCAA AACAAGCATTTTTGGACAACACAACAGGATGACGCACTGATAGAGGCATTGTTTGAATTGAGTCAAAACGCGATGTGGCG GGCTGATTGTGGTTTTAAAAATGGGTATTTGCTTTAATTGGAGACAATGATGGAGGCAAAATTATCAGGTTGTGCCATCA AAGCATCTCCTCATATTGAATCTCGTGTGAAATGGCTTAAGCAAAAATATTGTGCAATGACAGATATGTTGTCTCTTAGT GGGTTTGGATTGGACAATGATAAGATGGTATTACAATGTGAAAAAAATGTGTATGATGAGTATGTTGAGGTACATGTAAT AAACTTTTTTCACAATGGTTGTTACTTGGTTATTATTTAGTGAATTAACAAATGCTATTTAACTTGTTTAACATAAGCGA AAAGATGCTGCTGGTTTATATGAAAAACCTTTTCCTCATTATTACACTTTGGGTGAAATTTATGGACGTGATTGAGCTAC AGGCATTGGTGCTGGAAATGCAGATGATGATGAGGAAGAGGTTCGCCA >DTH_2_6_Mno length=2528;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; AGAGTAGTAGAACAACAAAACTACGTACTAGCTTTTCATCCTCTATTTTTGTCTTCTAGCTTTTTTTTTTCCTTTCAGAG TACTAGAACAGCAAAAACTAGAGTACTAGAACACATAGTAATTCTTCTAGTTTTTTTTTATCCCTCTTTATTTCTTTAAA CTCTTATATCTGTTTTATTTTAGAAATTTCTACTGTCAGATTAGAAAACTGAAACTATCAATAATTTTTATCCCTCTTTA TTTCTCGTGATTCTAGTACTCTAGTTTTTTTTTCTTTTTTTTCTTATAATTTGATTCTTGTGTTATGCCTATTGTTGTTC ATTTTTATAATATACAATGTGATACTAAATTTAATTTAATATGTTGATAATGTAGAGTAATCATGTCTAAACTTTTAGTA CGAAAGAAGAGAGTGGTTATAGTGATAAAAGAGATAGTTATGATGTTACAAATGATTATGGTTGTGCGTGCTACTATGTG TACCTATGTTTCTATTTATTATGAACGAAGGATATGAAGTCCAAAGATGGTTATAAGGGTTTATCAACAATTAGGTCACT TGTATGATTTGGTTTACGAGAGTGATATCAAGTGTGTGGCACAATTAAGAATGGATAGAGAAACATTTAGAAGATTATGC ACTTCTATGTGAGAAAGGAGGTTTGACAAGCACAAGAAATGTATCTGTTGAGGAGATGCTTGCAATGTTTTTGCACATCC TAGCACATCATGTTAAGAACAGGGTGATTAGTTTCAATTTTATGAGATCCGGAAGAACGATTAGTAAATGTTTCCACGAG TGTTTAAAAGCAATTATTCGGTGTCAAAAAGAATTTTAGAAAAACCCAGAACCAGTTTTGGAGAACTCAACTGACCCTAA ATGGAAGTGGTTTAAGGTATGTGTTCTCTTTTTTTTATTATTTTGAAAAAATTTGTTTTAAATTATATTTGTGTTCTTAA AATTTTATGCTTCTTTTTCATAATAATGTAGAATTGTTTGGGAGCATTGGATGGAACGTATGTAAGAGTTCGTATGCAAG AGGCAGACAAATCAAGATATAGAACAAGGAAAAATGAGATTGCTACTAATGTCTTAGGAGTTTGTTCACAAGACATGAAA TTTATATATGTCCTACTGGGATGGGAAGGTTCAACGCACGATATACGTGTGTTAAGGGACGCAGTGACTAGAAGAAATCG TTTAAAGGTTCCTAACGGTAATTTTATACAACAACACTAAATTTTTTTAATGACATTGTATTGTTTGTATATTATCTATT TGCTCATTGTTTAATATTGTTACTTTTTATATTGGCGGATAGGTTATTACTACTTGGTAGATGGTGGCTATAGTAATGGG ACCGGTTTTCTTGCACCATTTAGAGGACAACGTTACCATTTAAGTGAGTTTAACAATAGAAACCAACCAACTTCGGCGGA AGAGTTTTTCAACATGAAGCACTCGAGTGCTAGGAATGTTATTGAGCGGTGCTTTGGATTATTAAAAATGCGATGGGCTA TACTAAGAAGTCATTGCTTTTATGACATAAAAATACAACGACAAATAATTTCTGTATGTTGTATGTTACATAACTTTATT CGAAGAGAAATGGCTTATGACCCTATGGACATTGTGTACGATAATGATCCAGCACAACAATTGAACAATGAGATGGAGTT TATTGATTCCATTGAGACATCTACCGAGTGGACTACATGGAGACAAAATTTGACACAAGAGATGTGGACTGAATGGCGAG CGAGTAGAGAATAGGATTAAGGATTGACTTGTTTGAGAATATTTTTTTATCATTTTTATGCATTGAGCATGTTATATTGG CATGTTATTAATGTTACATACAGACAAAATTATACAACTTTGTTATATGGTTTAGTTATATTTTATACATGACTTGTTCA TTTGTTATTTAGAATGAGTTCCATTCCAGTTTCTTCAACTCAAAGAGGACGAGGTCTAAACAAGCATTATTGGACAACAC AACAAGATGACGCACTGATAGAGGCATTGTTCGAATTGAGTTAAAATGCGATGTGGCAGGTTGATTGTGGTTTTAAAAAT GGGTATTTGCTTCAATTGGAGACTATGATGGAGGCCAAATTACCAGGTTGTGCCATCAAAGCATCTCCTCATATTGAATC TCGTGTGAAATGGTTTAAGCAAAAATATTGTGCAATGACAGATATGTTGTCTTTTAGTGGGTTTAGATTGGACAATGATA AGATGATATGACAATGTGAAAAAAATGTGTATGATGAGTATGTTAAGGTACGTGTAATAAACTTTTTTCACAATGGTTGT TACTTGGTTATTATTTAGTGAATTAACCAATGTTATTTAACTTGTTTAACATAATCGAAAAGATGCTGCTGGTTTATATG AAAACCTTTTCCTCATTATTACACTTTGGGTGAAATTTATGGACGTGATCGAGCTACAGGCATTGTTGCTAGAAATGCAG ATGATGACGAGGAAGAGGTTCGCCAACAAGATACCATGAATGTAAATT