>DTH_2N_1_Mno length=126;Class=DNA transposons;Order=MITE;superfamily=MITE; GAGCCCGTTTGGTTCATGGATTAGAACCATTTTCGATTTACGTGTGTTTTTTGTGAGAGAAAATACTGTAGCGAACCATG AACCATGATTCGAATCAGAGAACGAATCCTCCAACCAAACGGGCTC >DTH_2N_10_Mno length=132;Class=DNA transposons;Order=MITE;superfamily=MITE; TGGTTGGAGGATTCGTTCTCTGATTCGAATCATGGTTCATGGTTCGCTACAGTATTTTCTCTCACAAAAAACACACGTAA ATCGAAAATAGTTCTAATCCATGAACCAAACGGGCTCTAAATTTTTATAAAA >DTH_2N_11_Mno length=158;Class=DNA transposons;Order=MITE;superfamily=MITE; AGTGGACGTTTGGTTCATAGATTTAGAATCATGATTTAAAATTATTTTTGATTTACGTGTATTTTTTATGAGAAAAAATA CTGTAACGAATCACGAATTATGATTCAAATCATGATACGAATCTACCAACTAAACGCACTTCATTTATATTTCATTAA >DTH_2N_12_Mno length=137;Class=DNA transposons;Order=MITE;superfamily=MITE; TGTGCGTTTGGTTGGTAGATTCGTATCATGATTTGAATCATAATTCGTGATTCGTTACAGTATTTTTTCTCATAAAAAAC ACACATAAATTGAGAATGATTCTGAATCATGATTCTAAATCCATGAACCAAACGTCC >DTH_2N_13_Mno length=120;Class=DNA transposons;Order=MITE;superfamily=MITE; TAAGGGGACGTTTGGTTCATGGATTCAGAACCATTCTCGTTTTACGTGTGTTTTTTGTGAGAGAAAATACTGTAACGAAC CACGAACCATGATTCGAATCATGGCACGAATCCCCCTTCC >DTH_2N_14_Mno length=130;Class=DNA transposons;Order=MITE;superfamily=MITE; GTTTGGTTCATGGATTCAGAATCATGATTCAGAATCATTCTCGTTTTACGTGTATTTTTTGTGAGAGAAAAACACTGTAG AGAATCATGAATCATGATTCAGAATCATGGACGAATACAGGAAACAAACA >DTH_2N_15_Mno length=208;Class=DNA transposons;Order=MITE;superfamily=MITE; GAAACGTTTGGATCACGAATTAGATACTTTATAAGTTTTTATTTATTGTAAATTTTGTGAGATCTTCATATATTAGTTGT TGTTTAGTTGAGAGATTCATTTTCTGATTTGAATTATGATTTATAATTTGTTACAGTATTTTCTTTTATAAAAAATACAC GTAAATTAAAAATAATTCTAATCACATGATTTTAATCCATGAACTAAA >DTH_2N_16_Mno length=133;Class=DNA transposons;Order=MITE;superfamily=MITE; GTGGACGTTTGGTTTATAGATTCAGAATCATGATTTAAAATTATTTTTAATTTACGTGTATTTTTTATGAGAAAAAATAC TATAACGAGTCACGAACTATGATTCGAACTATGACACGAATCCTCATACCAAA >DTH_2N_17_Mno length=93;Class=DNA transposons;Order=MITE;superfamily=MITE; GATTAGAATCATGAGATTAGAACTATTTTTGATTTACGTGTATTTTTTGTGAGAGAAAACACTATAGTGAATCATGAACC ATGATTCAAATCA >DTH_2N_18_Mno length=101;Class=DNA transposons;Order=MITE;superfamily=MITE; TGGATTCAGAATTATTCTCAATTTACGTGTATTTTTTATGAGAGAAAATACTGTAACGAATCACGAACCATGATTCGAAT CATGGCACGAATCTACCAACC >DTH_2N_19_Mno length=130;Class=DNA transposons;Order=MITE;superfamily=MITE; AGACGTTTGGTTCATGGATTAGAATTATTTTTAATTTACGTGTATTTTTTATGAGAGAAAATACTGTAACGAATCATGAA TTATAATTCAAATCATGATATGAATCCTCTTACCAAACGTCTCTTAAATT >DTH_2N_2_Mno length=96;Class=DNA transposons;Order=MITE;superfamily=MITE; ATACTCAAACCATAATTCTTGATTTTGACGTTTGAAATTCAAATTTTTTGTGAGAGAAAAATACTGTAACAGAATCAATA ATTTGAGTTTGAGTAT >DTH_2N_20_Mno length=131;Class=DNA transposons;Order=MITE;superfamily=MITE; AGAGGACGTTTGGTTTATGTATTCAGAATTATTCTCGTTTTACGTGTATTTTTTGTGAGAAAAAAATACTGTAGAGAACC ATGAATCATGATTCAGAATCAGGGACGAATATAGGAAACAAACGTCCCCTT >DTH_2N_21_Mno length=84;Class=DNA transposons;Order=MITE;superfamily=MITE; TGATTCAAATTATAATTCGTGACTTATTACAGTATTTTTTCTCATAAAAAATACACGTAAATCGAAAATAATTCTGAATC ATGA >DTH_2N_22_Mno length=82;Class=DNA transposons;Order=MITE;superfamily=MITE; AAAATTATGATTCATAATTATTTTTAATTTATGTATATTTTTTATGAGAAAAAATATTATAATGAGTCATGAATTATGAT TC >DTH_2N_23_Mno length=80;Class=DNA transposons;Order=MITE;superfamily=MITE; CATGATTTATAATTTATTATAATATTTTCTCTCATAAAAAATACACGTAAATAAAAAATAATTCTAATCTCATAATTCTA >DTH_2N_24_Mno length=134;Class=DNA transposons;Order=MITE;superfamily=MITE; CGTTTGTTTCAAGGGTTCTGTCTGGTTTAGGATCATGGTTCTTAGTTCTGTTACAGTGTTTTTCTCTCACAAAAAATTTA AATTTTAAAAATCAGAATCATGAACTATGATTTTAAACCCATGAACCAAACGTC >DTH_2N_25_Mno length=95;Class=DNA transposons;Order=MITE;superfamily=MITE; GGTTCAGAATCATGATTCATGATTTTGATTTTTGAAATTTAAATTTTTTGTGAGAGAAAAACACTATAGAGAATCAAGAA CTATGATTCAGAACC >DTH_2N_26_Mno length=131;Class=DNA transposons;Order=MITE;superfamily=MITE; GGGCTCGTTTGTTTCATGCGTTTAAACTCATGATTTTGATTCTGCTACAGTGTTTTCCTCTCACAAAAAATTTAAATTTC AAATGTCAAAATCAAGAATCACTGGTTTAAACGCATGAACCAAACGGGCCC >DTH_2N_27_Mno length=114;Class=DNA transposons;Order=MITE;superfamily=MITE; ATATGGGTTCTGCTACAGTGCAAACCCATGGTTTTGGTTCTGCTACAGTGTTTTTCTCTCACAAAAAATTTGAATTTCAA AAGTCATAATCAAGAACCTTAGTTTGAACCCATA >DTH_2N_28_Mno length=101;Class=DNA transposons;Order=MITE;superfamily=MITE; TGCGTTTAAATTCATAGTTTTGATTCTGCTACAGTGTTTTTCTCTCACAAAAAATTTGAATTTCAAATGCCAAAATCAAG AATCACTGATTTAAACGCATG >DTH_2N_29_Mno length=131;Class=DNA transposons;Order=MITE;superfamily=MITE; ATATGGGTTCTTCATGGGTTCAAACCCATGGTTTTGATTCTGCTACAGTGTTTTTCTCTCACAAAAAATTTAAATTTCAA AAGTCATAATCAAAACCACTGGTTTGAACCCTGGTTTGAACCCATATACCA >DTH_2N_3_Mno length=133;Class=DNA transposons;Order=MITE;superfamily=MITE; AGGGCCCGTTTGTTTCATATACTCAAACTCAAATCATTAATTCTGTTACAATGTTTTTCTCTCACAAAAAATTTAAATTT CAAACGTCAGAATCAAGAATCATGGTTTGAGTATACCTTCCAAACGGGCCCTA >DTH_2N_4_Mno length=143;Class=DNA transposons;Order=MITE;superfamily=MITE; TAGGGGATGTTTGGTAGGGGGATTCGTTCCCTGATTCGAATCATGATTCGTGGTTCGCTACAGTATTTTCTCTCACAAAA AATACACGTAAATCGAAAATGATTCTAATCTCATGATTCTAATCCATGAACCAAACGTCTCCT >DTH_2N_5_Mno length=161;Class=DNA transposons;Order=MITE;superfamily=MITE; TAATTTAGGGGTTGTTTGGTTGGGGGATTCGTACCCCGATTCGAATCATGGTTCATGGTTCGCTACAGTATTTTCTCTCA CAAAAAATACACGTAAATCAAAAATAGTTCTAATCTCATGATTCTAATCCATGAACCAAACGTCTCCTAATTTTTCTTAT T >DTH_2N_6_Mno length=271;Class=DNA transposons;Order=MITE;superfamily=MITE; CGTTTGGTTCATGGATTAGAATCATGAGATTAGAATCATTTTTGATTTACGTGTATTTTTTGTGAGAGAAAACACTGTAG CGAACCATGAACCATGATTCAAATCAGGGTATGAATCCTCCAACCAAACATCCCCTAAGGGGATGTTTGGTTGGAGGATT CGTACCCTGATTTGAATCATGGTTCATGGTTCGCTACAGTGTTTTCTCTCACAAAAAATACACGTAAATCAAAAATAATT CTAATCTCATGATTCTAATCCATGAACCAAA >DTH_2N_7_Mno length=245;Class=DNA transposons;Order=MITE;superfamily=MITE; AGGGATTCGTTCTCTGATTCGAATCATGATTCGTGGTTCGCTACAGTATTTTCTCTCACAAAAAATACACGTAAATCGAA AATGGTTCTAATCACATGGTTCTAATCCATGAACCAAACGTCACGTTTGGTTCATGGATTAAAACCATGTGATTAGAACC ATTTTCGATTTACGTGTATTTTTTGTGAGAGAAAATACTGTAGCGAACCACGAATCATGATTCGAATCAGGGAACGAATC CCTCT >DTH_2N_8_Mno length=129;Class=DNA transposons;Order=MITE;superfamily=MITE; GTTTGGTTCATGGATTAGAACCATGAGATTAGAATTATTTTTGATTTACGTGTATTTTTTGTGAGAGAAAATACTGTAGC GAACCATGAACCATGATTCGAATCAGAGAACGAATCCTTCAACCAAACG >DTH_2N_9_Mno length=146;Class=DNA transposons;Order=MITE;superfamily=MITE; TAGAGCCCGTTTGGTAAAGGGATTCGTTCCCTGATTCGAATCATGATTCGTGATTCGTTACAGTATTTTTTCTCATAAAA AATACACGTAAATTAAAAATAATTCTAATCACATAGTTTTAATCTATGAACCAAACGGCCTCTTAA