>DTH_19_1_Mno length=2435;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; AAAAATGTTAGCCAGAAAATTTTAATCTGCTTATGCTTCTCAACTATGTTTGTCCAGAGATATCTTTATCAGGAAATTGT ATCTGATCTGATAAGAGTGGAAGAGAGACATTAAGTACCTACCACGCAGATCTATATTCTTTATGGTCACGCATTTTTAG AGGTTAATGCCAAAAAAGAAATTTTTTAACCAAAGTAGTAGAAGAGAAACAAGATAGTGGTATTATTTGGCTGCAGTTCA GTTTTTATGTTTTAGCTGCTTTTACTATGTCTTTCCGAGTCTACCTACATGCTTATAATTGAATATTGTTACTAATAATT CTAGTTATTAACTGAAAAAGTGATTGTGTAACTACTTTACAGTTTTGACTGAAAAATTTTCATATGCAAATTAGTTGCAT TGGAATCTTGATAAAAGTTGTTATAACTACTCTGGTTTATAGTTCTACTCTTATCTTCGTTTGCAAGTTAACTCTCTCTG ATTATAGTATGGACTTCATATGAATCTAAGAATTATGTCCTGTGTAGCCGAGGCTTTCCTCGTGTTTAGTTTTGCTATAT ATTAACATATATATATATATATATGAGAGTTATATTGAAAGAACTATAATATTCTTGTTTTCCTCTCTGCAGGGCCTTTG TCTCAGACAATGACATTTGAATCCATTTTCAAAATTTCAAGGAAGACATTCAGCTACATCTGCTCACTCGTAAAGGATGA TATGTTGGCTAAAACCTCGTACTTTGATTATAAAGGGAACCCTTTGTCTTTGAATGACCAAGTAGCTGTTGCTCTTCGGA GGCTAAGCTCAGGCGACTCATTGTCTATTGTTGGTGACTCATTTGGGATGAATCAGTCAACAGTTTCTCAGTTAACCTGG CGGTTTGTGGAAGCAATGGAAGAAAGAGGACTCCACCATCTCTGTTGGCCTTCAACTGAAGCAGAGATGGAAATAATAAA GTCCAAGTTTGAGAAAATCCGCAGTCTTCCAAATTGTTGCGGTGCAATTGATACCACACACATCATGATGACTCTTCCTA ATGTGCACCCAGATAATGATGTCTGGATTGACTATGAAAAGAACAGCAGCATGATCTTACAGGCAATCGTTGATCCGGAA ATGAGATTCCGCAACGTAATTGCTGGATGGCCAGGAAGTTTGAGTGATGCCATTGTGCTCCAAAGCTCGGGTTTTTTCAA ATTGTCCGAAGATGGGGAGAGGTTGAATGGGAAGAAGATAGTTCTCTCGGAAGGAACAGAGTTAAGAGAATACATAGTAG GAGATGCAGGTTTTCCTCTTTTGCCATGGCTGCTAACCCCATACCCTAGACGAGGCCTATCAGATTTTCAGGCCGAGTTT AATAAACGGCATTATGCCACACGAATGGTGGCACAGAGGGCATTGGCAAGGTTGAAGGAGATGTGGAGGATAATTCATGG AGTCATGTGGAAGCCTGATAGGCATAGATTGCCAAGGATCATTCTTGTGTGCTGCATACTCCACAACATCATTATCGACA TGGAAGATGAGATGCAAGATGAAATGCCCTTCTCACACCATCATGATTCTGGTTACCGACAACAATGTTGTGAATCCGTC GACAAGTCTGCCTCGATTCTGAGAGAGAAGCTTTCTCTACACTTGGCTGGAACCACTTGAGAAAGATGCCTCAGTCTCGG GAAATGGTCATCTTTGATTTCTTTCACTCATGAACTGCTATGTCTTCTTGAATTGAGACTATACATAGTGCAGTAATTCG TTTACAGAAATAGTTTTGTCTATTTTAAACATAAATCTCTGATAGATAAGAATATTTTTTGGCCTTTCCTTTGTGCCTCA GAAATCAGTCTTTTACATGCACAAAGGTGATTTCGCTGCTTCATTTTCCTTGATAAAGTAGGTTGAAGAGTCTGATTATC TCAGTACAAGATACGAACCCAAAATGGATCACCAACAAACACCTATTAGTTGATCATTTATACATAGTGGTCGCACCTTA CAAATAACGAATCTTTTCCTGTGTCCGGATTAAATTCCAGAGTTTTGTAGCCCGAATAAATTGGAAGACAAAAAAATCAA GCTCGGTGGAAGATTTTAATTGGTGTATGTTTCATTTTCACATGACCATTGTAAAAGGAAAAAATAGTCAGTTCTTCAAC GAAAACATATTTGTCAACAATCCACCAAGGTACTGTACTATAAAGAGAACAATCTTTAAGGCTTCATCGCTTTTTTCTCA CTTCTTTCTTTAGATTTTCCCGTTTCCTCATATACCTTCCAGTCTATAATAATAATAATAATAATAAAGACCTTGAATAT TCCGCGAAGATTTAAAATCGCTTCTTTGTGTTTAAGATGCAACTGCATGTACGTTTAAACAGAGAGGAAAGCAAACTAAA GGAAGCAAAAACAGAGAAAATAACAGCAAGTTTAA