>DTH_18_1_Mno length=2436;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; AAACTCCATGAACACTCATCAACCAATGAGGTCAAACTCTATGGACATGCAACCAAACTCTGAGGTAATTGCTTGTTTTT TTGTTTCCAACTTGCTTGTGTTTAGTGAGTGGAAAGACAATCAATTATGTATTTATTGCCTAACTACTTGTGTTTAATGG TTGAGTTTCTATATATGTTTCTATACCAGAGCTTAGTTGGCATATTGAATTGCCTGCAGTTTTTTTCTTTTGTAGGGCAT TGTGCTATTGTTTTGTATATACATGTTAAAGTACTCTGTTTTATTAGTGATTCAATATTTTATGTGGTGTGTGATCTCAT TTCGTTGAAATCTGCTGTTGTCTTTTTTATTTGAAGAAGATATATGATCTTAGATTATACTCATATTTGGGTTTTGGTTC TTTAGGAAGAAATGGAAAGTTTGAGAAAAAGGGCTGTAGTTATGGTCATGATGTATGTTGCATATGCAGCAACCCTTGTC TTAACCCGTTGTATCAACCAAATCGAACGGTCGATCACAAGACATAGAACTTATGAACGAAATGTTATAATGACAAGACT TACCTTAATGAGTGATGAGCTTGTTGTAGCCAGCTACGAATGGGAAGAGAATCATTTGGTAGGTTGGTACAACTACTCCG CGACACTGGTCGCCTCAGTGATACTTGGTTAGTAGTGTGGAAGAACAACTCGCAAAGTTTCTTTATTTACTAGGCCAAAA TGCGAGAAATCGTAATGTAAAATTCACGTTCTTTCATTCTACTGAGACTGTAAGCCATCATTTCCACCAAGTTTTGGGGG CCATCATATAATTCATGATATATTCCTAAGGCAGGATGGATCACAATACCCTCCAGAAATTATTAGTAATTCTAAAAATT GGCCTTTTTAAAGGTAATTTTCATTATTTTATGTTTATTTTATGAATAATAGGTATATCCATAGACCCGTACCTCCAATT AAACGTAGAAGGTTTTACAGGATTGTACAGGTGCACTTATGGCTCCCATTTTCGTGTCAAGGTTCCCAATGATATCGTGA AACGATTTCGAGGTGTATGCAATTTTGATTTGACATTTTCATATGTCTTGGCTGGTTGGGAAAGATCCGCCTCTGACTCT AGGGTATTGAATAGTGCATTGACAAGAGAGCTTGATAGATTAAAAGTACCTCAAGGTAAATAACTGATGTTTTAAGGATT TAAAGTATATTATCTATGAAATTCTAGTAGTAATTGTTGGTCTTTTTTATTTATAAATCATAGGTAAGTATTATTTAGTA GATGCTCTATATTGAAGTACACGGTATCACTTAAGAGAATATAGTGCATCTCAACCACAGCGAAATGCTAGAGAACTTTT TAACCTCAGACAATCATCATTGAGGAATGCTATTGAGAGAGCCTATGGTGTTTTAAAGAAGAGGTTTCCAATACTAGGCA GTGGTGCTGATGAGCCTTTCTATTCAATTCGGACGAAAGTGAGAATTGTTATTGCTGGATCTATTTTGCATAATTTTCTA ATGGGTGTTGATAATAATGAGGAAATTGTTGTAGAAGTTGATAGTGAGCGTAGTGACCCATCAAGGCCAATACCATCATC TGATGTAGATGAATCAATTCAAACCCAAGAGTCTAGGAGCCATGAATATATGGAGGGTGAAATGCTAAGGGAGCAAATAG CTATTTCAATGTGGAATGCATATTGTCTAAACAACTAAATGTGTAAAAGAGTGTTGGAATTCAGAATTCTTTTGAGTTGT AGAATTCTTTTGAGTTGTAGCTATTTCGATGTGGACTGTATATTGTTTTTGGACTTGTAGTACACTGTATCCCAGTGAGA ATTCACTTGGCTCAACATTTATTATTTTTGATATGCTCTTCTGTTGGTTTGGCTTATTTGCTTATGAATCTGGTTGAGTT TTTATTTTTTTATTTTTATTCTACATAGAGAAGATTATGAAGATGTAGAAACTAATGCTTATATGGGAAAAAAGAATTTA ACCTGGAATGCCGTAGTAGTGGTTTTGGGTTTAATCATCATACTCAAATGATTGAGGCTGAAATCTCTGTTTGGGAAGCT TATGTCAAGGTAAGATTTGTTAATATTGTTGTATATTCTTCTTATCCAACTCCATTTCTGGTTAATTATAAAGTTTTCTT ACAGATGGATATGTTGGTTGTTGTAGGCACATCCGAATGCATCCAAACTTCGTTACAAACCTATTAAAAATTATGATAAG ATGAACAGTCTATTTGGACAAGAACGTGCAAGGTTTCGGTGCAGGTGTTGGCGTTTATACTCTTAAAAATAAATGTAATA ATGCTTATTAATAAAAATTTATTTATTTATATATTTATGTATTGTTTTCTTTATGTTCATATTAATTGAATGTGTGATAA GCAAACTGAAAGTCTGAGACTCGTTTTAAGTCTTTA