>DTH_17_1_Mno length=2438;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; AATCATAATGTGCATTTCTGGTATATGTAAAAGTAATGCAACTCTGTGTGGATCAACTTGTGCAAAAGAGAGCACATTTA GGATCTTTTAGTATTTAGATTATTTCTGATACCTAAAATGAAATAAGAGAAGATCATCTTAGGGAAAGACTCTTCTTTTC CTATGTTATTCAGCATTTAAGTGGGTTGTCTCTTGCTCACTGAGCAAGCACTAGCCACCAGTCCTGTAATCTTCTAACTG CATATGTGTATGGATTTGGCGTCAAGGGTTTATGTTCTTATGTAGTTAGACAATCATACGCAGTAAGTTCTGTTTCACAA TATTTTCCGTCACTTGGATTTATCTGCAACACTTGGTGCACATAGATTAATGTATAATATGATTATGGTTGCCTTATTGT GTCCTGTTTTTACATCAGCTTTCCATATGCTTCGTATATCTCTGATGTTAATTGACAAAAACTGATGGTTTTAGCAAATT AGTACATATACCTATTTAATTGACATGAAAAGTGTTGATTCTATTATTTGTTGCAACATCCGACAAAGAAGCATTGAAGT CAAATAAAAGAACTCTAGTTTGGAGTTGTAAATATTGTTTTCCTTCTGCCTTCATGGCAGGTCTTCAGTCTCCATCAAAA CGTTTAGACAAGTTTGAATCTGTTTTTAAGATGTCCCGGAAAACCTTTGACTACATATGTTCACTTGTAAAGGAAGACAT GATGGTGAAGTCAGCTCATTTTGTGTTTGCGAATGGCAAGCCTATGTCTTTATGCGATCAAGTTGCTGTTGCATTAAGAA GGCTGAGCTCCGGTGATTCACTTGTCACAATTGGCGATTTGTTTGGGCTGAACCACTCAACCGTCTCCCAAGTGACGTGG CGATTTGTGGAATCCATGGAAGAAAGGGGGCTTCACCACTTACATTGGCCTTCCACAGAAGCGGAAATGACAGAAATCAA GTCCAAATTTGAGAAAATCCGGGGCTTCCCTAATTGTTGTGGGGTCATTGATACCACCCACATTGTGATGTGCTTGCCTG CTTCAGACCCCACAGGCGATGTGTGGCTTGATCATGAGAAGAATCACAGCATGGTCTTGCAAGCTGTCGTGGATGCCGAC ATGAGGTTCCGGGACATAGTCACTGGATGGCCAGGAAAAATGAAGGATTGGTTGGTTTTTGAGAGCTCAAATCTCTACAA ACTTTGTGACAAAGGAGAGAGGTTGAATGGAAAGAAGGTAGAGATTTCCAAAGGATCAGAAATAAGGGAGTACATAGTTG GTGATTCTGCCTATCCTTTACTTCCCTATCTTGTGATCCCCTATGAAGGAAAAGAACTTTTGGAATCAAAGGCCGACTTC AATAAGCGTCATTCTGCAACGAGGATGGTCGCTCAACGCGCATTAGCTAGGCTGAAGGACATGTGGAGGATCATTCAAGG AGTAATGTGGAGACCTGACAAACACAGATTACCAAGAATCATTCTTGTATGCTGCTTGCTTCACAACATTATCATAGATA TGGAAGATGAGGCGCAGGATGAGATGCCATTGTCTCACAACCATGACTCGAATTATCACCAAGAAGTCTGCGGAACCACA GACAACGAAGGTACGAACTTGAGAGAAAAGCTCTCTCTTTACTTGTCTGGAAGGATGCCACCTTAACTGCGTTCCATTTC TAATTGTTCAAATAGTTGTTTAAAGATTGTTTGTCTTTTAATCTACATAATTAATTTTCCCCGAGACAGACTCCCTTGAA ATGAAAGTTATATTACAGGATCTTTTGTTTTAGACAAAAGTTTGATCAGGACCTCATATTAGTTATTCCATGTATTTGTT TTAGTAGAAATCATTGCTATTTTTCGATCTTCATCTGTTAAATTATCATGTTTATCTTAATCTAATACGATTAAAATGCA TTCTACTAGTAAAGTAATAGCATAGAATTCTTGATACTTTTGCTAAACTTCATCGGCAGTGCCTCTACTCTTATTTGTTG ATGTCCCAGTGTCCAAATTTTCAAGCCCACGTGAAAAGCACGCAACTTTACAAATTTTATTTGTGAGCTTCTCTGGTGGA TCAAGAAAAAAAAATTACCGGTAATTTTATGTTTTTGTCGTTAGATCTGAATTAAAAACTGTCTTTTCTGTATACTTTTT TAATCTAATGTGATTTTGACCAGACCTAATGGTCAGAAATAAACCCTGCTGATAGAGAGGCTCTACCAGAAAAAAATCTT AAATTTATACATTGAATTACACCACACTATTCAAATTTCAATTCTTGCGCGAATCACATCTTTATATTAATAGGTGTTTA AAACATTATTACGTCAATTAATAATAAGAGATTATATCTAATAATAAAAAATAGTAATTCATATGTCACATCAATTAATA CACTAAAATTTTAAAATTTAAATTTGAGTTGATGTTCA