>DTH_16_1_Mno length=5177;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; GTTTTTGTTCTTGCAAAAATATATAAGAAAAAGTAAAACAAGAATATTACCTGAGCAGATTCCGTTGCCTCGTCGACAAC TGTTCGAGAAATGGCCGTTTTAGTTGAGGAAGAAGAGCTTGTTTTTTATGCCATTTCAGTCTAAAAGCCACCGGTTTTTA GTCAGATTTTGGTGAGCAGGTGGTCAGTTTTTGTGGTCGGGAATTTGGTGAGTGGTCGGGGTCGGTTTTTGGTCGGTTTT AGTGGGAAGGGAGTCGGTTTTTGATGAACAGTCGGTGTTTGGTGAGGTGCTCGGTCGGCCAAGACGAGAGAGAACGGAGA GAGAGAGAGAGAAACAGGTGAGAGGAAAGCCGGCGGTCAGTAGTGAGGTTGGTGACTGATCGGAGAGAAAAGCCGGTGGT CAGCGAGAGGTGATCGGAGAGAAAAACCGGTGGTCGGTCGTGAGAGAGCTCAGTCGAGGGAGAAAGGGTCGAGCGGTCGG TTTCGAGGGGAAGAGAGGGTCGAGCGGCAGTCAGTTTTGTGAGGAATGAGTTTTTGAAAATGACCTAGGACTAATAGGAC CCATTTTTTACCACGTAAGATACACGTTATCATTTTTTTGTTATAAAAAAACTGGTCTATTTTCTCAAATTTTGATTTGC TCCGGTCTCTTTTATCAAATTTTCTCTTTTGGACCCTCCAGACGACCCATCCTCTCCTCCGCCGGCTTCCTCCATCGCAT AAAAAATCCTAATTTCCTTCCTATCAGAGTTTCACCAGATTCGAATCAAAATCCAACAACAGAAAAACAGAAGTTGTAGA AATTTCGGAAGAAGAAGAAGATGGATCAAACCTTCTTACTGATGCTCTCGAACCTTCTCCACCTCCAAAACTCCCTCGAC CCAACCACCTCCCTCCTCTCCGACACATCCTCCTCCTCCTCCGCCGCCTCCGCCGCCACCGCCTCCTCCGCCTCCGCCTC CTCCCCCTCTTCCCTCCTCACCTCCTCCTCCTCCGCCGCCCCTCTCCTCTTCTTCACCATCGCCTCCGTCCTCTCCTACA TCGCCTCCTCCTCCAAACCCTCTTCCTCCAAATCCGCCGCCACCAAATCCTCATCCAAATCCTCCGCAGCCGCCGCCGTT GACTACTCCGTCTCCGCCTTCCGCGCCCTCTCCACCGAGCACATCTGGTCCCTCGAAGCCCCTCTCCGCGACGCCCAATG GCGGTCCCTCTACGGCCTCTCCTACCCCGTCTTCACCACCGTCGTCGACAAGCTCAAGCCCCACATCGCCCTCTCCAACC TCTCTCTCCCCTCCGACTACGCCGTCGCCATGGTCCTCTCCCGCCTCTCCCATGGCCTCTCCGCCAAAACCCTAGCCTCC CGCTACTCCCTCGAGCCCTACCTCGTCTCCAAGATCACCAACATGGTCACTCGCCTCTTGGCAACCAAACTCTACTCCGA GTTCATCAAGATACCCGTCGGCCGCCGCCGCCTTCTCGAGACGACTCAGGCGTTTGAAGAGCTTACTTCTCTTCCCAACA TGTGTGGCGCCATTGATGGAAGTCCGATCAACCTCCACAAGTTTCCAAACGACGTCAAAATGCCCGCCAATTATAAGTGT CGATATGGGTTCAATTCGGTTCTCCTTCAGGTTGTGGCGGACCAGAAGAAGATCTTCTGGGATGTTTGCGTTAAGGCCCC CGGCGGGACTGACGACGCTGCGCATTTCCGGGACAGTATTCTTTACAACCGGCTTGTCTCCGGCGACGTCGTTTGGGACA AGGTGATCAACGTGAGGGGCAATCCAGTGAGGCCGTACATTGTTGGTGATTGGTGTTATCCCTTGATACCGTTCCTGATG ACGCCATTTTCTGCGGACGGGGGCGGGACGCCCGCGCAGAACCTGTTCGATGGAATGCTTATGAAGGGGAGGTCCGTCGT GGTTGATGCCATCAGGCTGCTGAAAGGGAGGTGGAGGATTCTCCAGAACTTGAATGTGGGCCTCAATCACGCACCGCAGA CTATAGTAGCGTGCTGCGTCTTGCACAATCTGTGTCAGATTGCAAAGGAGCCTGAGCCGGAGGTGTGGAAGGAGCCCGAG GAGCGCGGGAGTGTGCCGCGGTTGTCAGAGGGGGAGAAGTCATTTTATTACTTTGGTGAGAGCTTGAGGCAGGCCTTGGC TGATGACTTGCACCATAGGCTTTCTTCGAGATGATGATCTGGTGAAAAAGGCATGGCTTTTGGAGCTTTTGGTTTGATGT TAGAATGAATGTACTACTGTTTGTTTTTTTACTTATTGTTATTAGTAGGTATTACTATAAGTACATTTTGAGAAGTTTAA CCTGCAATGTAGTTTATGTGACCAACTAACGTAGAAATGGTATCTAAGGATTGCCATCAATTGGAAAGAGTNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGAGTGGAAATGTACGAGCGTT ATTTGTCTTAAGTGATTTATCATCAATCATATTTGCTCTTTTTGTTTCTGTTATGTATAATTGTATATTGTTTAATGTCA AGTTCCCCTTTTTCTGTTTTATGGCAAAAGAAGCTTTGTGAGATTAAAATTGGCTAAATATCTATGGAACTATGTTATAC AATAGGATACAATTTGGCTGAATGTTTACGGAGAATTCATGAACTTGATCCATGAATGAGAGCAACAATATGTTTATGTG AAACCTTTCCTGCATTTTTAGATGGCGTTATCCGTCCAAATTGTTCTGATAGTTGGTCTTAATATTCAATGGATGAAAGA AAATCTTGGGCTGTTGGTCCGATGACATGGCTTAGCAAGCAGAGTTTGTGTTAGTGCTGTGTATTCCGGAAAATGTCAAT GCAATTTTTGGAAGCGTGGACCAGATTTCTTCTGTTGCTTCTCTTGCAGTGCTACAAACTTTTTCTTTGGTTTTCAAGCT TTTCCTTGCAACAATGAGGATGTTAATGTACGACATCTGTTGGACTTTCATTTATGTTCTTGAGATGACAAATTTTTTTT TTTTTTAACCATTCATTCTCATAATAAAGAGAATATTTCATCATTGATAAAGATCTTTCTGCTAGCAACTCTTGATCGGT GTCATCCATGGTTTTTTCTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTTTCCTTTTTGGGTTGGTTTTCCGGGGGAAA TAGGTTGGCTTTCCAGGGGAAAACGTTTTTGTTCATTCGTTGGACAAAAAAGTAAAATAATAGAAAACTTAAGGCTCCTT CTTTTAGAGTTTAACTTGAGTATAATTCTTGAGTTAAATTTGAGTTATAACTTGAGTTGAACTTGTAATTTGAGTTTGTA TTTAGTTGTGTACATTTTAATTATAGTTTTAAAATTTTTTTGAGTTTGTGTTTGAATGAGTCAAAACTTGAATTTGTATT TAGATAGTATTTTAATAAAAACTCAATGCTGATGAAAAATTTTAATAGGGTATATGGATCGGGTTTTATTCGTCTTTTCG TTGTCAACGCATAGAAAAAAAAATCATCTCAATCAGAATTAAAACGAAAAAGTTATAGCATTTTTAAGAATAGAAAAAAT ACTGTTCATTAATTTGAGTTCGAGTTTCTGAACTCGAGTTGAAGGGGAAACTTGAACTCGAGATTTAGGCCTCGTTCATT TCATCGATTTGAGTTTTCAGTTTTAAGTTTCTACAATAAAAAGTTCTCAAAAAATATCACATTTAACTTTTTCTGTTACA GTGAAAAGCTCTCAGAAAATGTCACTATCTCAGCTCGAATTGAAAACTCAAATCCGCAAAGTGAACGAGGTCTTAGTTCT AAACTCAAACTCGAGTTTAAACTTAAAAAAACATGAATTCGAATAAAGTTGTAACTCGAGTTGTATTTCTTTTGAGTTAC AAGCCCTTAGATACTTGAACCCATAAAATATATTTCCCTCTGTATTCAAAGCTTTGCTATGACTATCGACCTTATTACAC AGTGGATACATAAAAATGTGTAGGGGCAAAAAGAGTTTACACAAGATTGTACATGACAAACTTTCAGCCAAAAAGGGAGT GAGAAAACAATGGATTGCTAATGTGAAGACCAAAACTTAAGGACAATGAAAGCCTTTCATCTATGTTCAGTTTTGGGTCA ATACATGAAATCAGAGGAGAGCACCTGAGAGAACGGAGACAACATTGACAATATCTCAGCAGATGTAACATGGAGGTTTC ATTTTTGGCTTTCTTATTTGATTGGAGAAAACTGACCAGTTATGCTATAACCGTGCAGAAAACATAACTTCCAGCTTGAT TCTGATAAAACTTTCTTGGCCGGATTAGGTCACATCCTTTTTACATGATCAGTACCATCTTCTTCTTAACCACGATTGCG ACAAGAGAATTGATGCTAGCCACAGCAATCATTTGTTAACTGAAATAAAGGGATCGATGATAAGTGCACTTTCAACATGA CAAAACCTAATAATAGAACTGCTATTTTCTGCACCATAATCTTTCCCCTTATACAACGATCATTCCGTTGAGAATTTTTT CTTCTTCTTTTTCTTTTTCTTATTCAACTACACTACAACCTGGACTTTTTTAGTTTGGAAGAACAAGAGTTAATGGAATT CCGAGAAAAGGAGGAATTCTGAAAAATCAACATGAAAAGAACTATGTTAAGATTATAATTTACACTTTACAGACAAGCAG CAACAGAAGAAAGAAAAGAGGAGACGAAAACACAAGGATAGCGTGAAGGTGTAATTAACAATAGGACGGTCAAGTACAAT GTTAATTTTATGAAAGCACGAACAAATTGAGAACAGAACAGAAACAGGATTCTTAGTCAGGTTTATTCTTCAATGCAGAG TAGTAAAAAGACAAACATATGGTGAACAGTTCAAACCAGATGCAAAATAATGATAACAAATAAAATAATTAATCATCGGA TGTATGCTTTGATATGCAAGCATGTGAGATAATATTACTATAATTTGTCAAGGCTTACCAGCAAGCAAAGCCAAGAGGAA TGATGAATAACGAGTCTCAGGCAAGTGTTTCAAACTGTACTTGGTAGAATAATGTGCGTTCATATAAGCTGCCAAAGCAT CGGTGAAAATTCGTATTTTGCATCTTCATCTTTGCCTAGGTCAGCCAAAACCAACAC