>DTH_15_1_Mno length=2492;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; ATTTGCTTTATATAATTTATGTATAAGTTTTTCTTAATTGTTTTGGATTCTTGAGCTTTGAAGCACTACAAGATGACTTG GTGGCCGGCGGGTCATTGCTATTATTAAATTAAACTCATCAGCATGCGTTTAAATGCTATGCTGCAAACTAAAAAAAAAA GCTGCAAACCATCTGTTTATTTGGTTATTGATATATTTTTTCCATTTCCAACTTATGCATTGTCTGCTTTGCAGCATCAC GATCATACGCTTGCCATATTCACCGCCCAAAAAAAAAGTTTAGGTTATTCCATTTGTATACTTTCTTAACTTTGGAAACG GTATCAACCTCCATTCAAGTGTGTCATACTTTTGGTTGTTTTGTTGTAGGATAATGGCTCGCTTAGGATTAGTCAAAAGT GAAACTTTGAGAAAGAGGAAGATAGTTGCTTTGCTTTTACATTGGTTGAATATTATGCATGTAGTGCAACAGTTCTTTCA ATTGATGGAAATAGTGGTGATGGAGGATATAGAATCAAACTTTGTACAGAGACAACTTTATGTGCTTGACGTGTTTGTTC ATAGGCAATATGTTCATCAACTAGCTTACGCAAGTGATGTCAAATGCAGAGATCAATTAAGGATGAATAGAAATGCCTTC ACTACTTTGTGCACATTGCTAGAAACTAGGGGTGGGTTGAAAGCGTCTAAGTATTTGCAAGTAGATGAGCAAGTGGCTAT GTTTTTACATACCATTGCTCACCATGAGAAAAATAGAGTTATAAAATCCCATTTTATGAGATCTGGACAAACGGTTAGTA AGTAATTTCACAATGTCTTGCATTCAATCATTCGACTTCATGGAGTGTTATTCGTTAGACCCGCGCCGGTTGCAGATAAC TCAACTGATGAGAGGTGGAAATGGTTTCAGGCACGTACCTATTTCTGTGTTATGTTTAAAATGGGCAGCACCCATGGTGT AATTAGTAATTATATCTTTTATTTATTATAGAATTGCCTAGGTGCACTAGATGGAACCTATATTAGGGTGAGAGTGCCTA TGACAGAGAGACTCAAATACCGTAATCAACATGGAGCTGTAGCAACAAACGTCTTAGGAGTATGCACACGAGATATGGAA TTTATATATGTGTTGCCTGGATGGGAAGGATTTGCAGCTAATGGTAGAGTATTACGCGATGCCCTACGTAGGGTAAGTTT GTTTGTTACTAGTAAAGTAGTTTACTCGTTCTTTGTTACATCGTTCGTTGTTACATTTAAATCTTATTTATCAATTCTTT TAACAGGATGTTACTATCTTGTTGATGCTGGATACACCAATTGTAAAGGATTCCTTGCTCCATTTCATGGCCAACGGTAC CATGTAAAGGAATGAAAAGATGGAACACAACCTAGGAATGCACAAGAGTATTTTAATATGAAACATTTACATGCTAGGAA TGTGATTGAGAGATGTTTTGGTGTACTTGAGAGACGTTGAGCGATTCTTCGTAGTCTATCGTTCTTTCCAATTAAAACTC AAAATCGCATTATCTTGGCATGTTGTTTGTTACATAATTTTATGAGGCGCGAAATGCCTAATGACGTTTCAGATCCAATA CCAGAAGATGAGTGTGAGAATGATGAAGAAGATAAAGAAGTAGAAGATAATGATGATTTGATAACGGCCGTTGAGGAGGA ATACTATAGTACAAGATATGTTTAATGACCGGAGGAATCGTAGGAATGCATGACAATTGTCTATGTGTTTTTCCCTTGGA AGTTGTAATGGAACTTGTATTATTTGCTTGTATTAGGACAAATTTATGTTGTTTGCATGTTTTATCCGGCACATTCGATT AATATGCGTCGCTTTGAATTGCTTTTATCTATAGTGTTTGCAAGTTACTAATTATATATCATAGAGGATGTTGATTCGTA ATTGTATACATATTTGTTTTTTGTTATTGTTAGGATGGACACTTCCAAATCTAGAGGTCCAAGTCAAAATAACAGGTTTC GGAATGAAGATAAGGATAAATTCTTAATTGAGGCTTTAATGGAGTTACATAACGAGGGAACATATAAAGCGGAAGGTACT TTCAAGGCTGGGTATCTGCACGCTCTTGAGAAAAAGTTACATAGCAGGTTGTCAGGATGTGACTTACTAGCTAGGCCACA AGTCAAGAAGGAAAATGTTTCACCGCTTCCTTTCTTCTAGAATTGAATTCCTCACCTATTCAGCGCTACTTCTAGCGTCA CTTGGGTGGGGTTATTACATTTTGAAACATAGGAAAAATGAGCGAAAGACACAGTAGGATAAGAGTTATAAAACTAAATA AATAAGTAAATAAAATGAGATAGTCAGGCCCGAAATAATCAATTGGAACTAAACGACCTTTTTCTGAAAGGTAAATAAAC TGAAATTTCATATTATAGGCAACTAGCAAGTAATTTAAGTAATTAAATTACTCATGACTAAAGCGAGGCCAAATGCCATC GTAGTGGCCCGT