>DTH_14_1_Mno length=2498;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; ATAATCTGCAAAACTATTGGGTTCCGCCCTATTTGTAGGCTGGAATAAATAATGGGCTTTAAATCTAAATGCCAACAAGG AAAAAAAAAAAAAAAAGAAGCATTAACAAAAAGCAAGAAGGGGCTGCGGTGAAGAGCAAGAAGGGGCTGCGGTGAAGAGC AACCGAGGGAACCAAAGAAAGAGAAGAGAGAAGAGAAGAGAAAAATGGTAGGATTTTGGTGCTTGTGCAAGACGATCAGG TAGCGAAACGTTGACGGTTTCGGCTTAAATTTGATGTGAAGAATTCTTGCGACGAGCTCTTCTCATCTATCGGACTTGAT TTCTCATTTAGTCTCTCTTTAGTACTCTTGAGTACTCCTATTTTAGTGAGATCTAAGCCTATCTTTAGTGCTATTGTTAT TATCCATCTTTGATGATGATGTCTATGTTGTTAGTGAGCCAAGAATAGTATTTTTGATGATATTATTGTTGTGAGCCTCT AGTTTGTATCTAGAGAGAAACTTTATAATCCCATTGTTGATATAGTGGAAGTTCTAAGTGGCCTACGGGTCCCGTAATTT TTACTCTCAATTTGAGGGGTTTTTCATGCTAAAAATTTGTCTCTTATTTGTCCTTGGTTGATTTAATTAGTTGTTCCTTT GGTTGATTAGTTTTGTTGGTATTTTGCTTGAGATCCTATTTTAGCACACAAAGAGAGAGTTTTATTCAGCAATTGTTAGT AATAGTCTTCCCAACAAACTGGTATCAGAGGTAGGTTGGCTAGACGCTATTTATTGTGTGTTAAGATGGAAGAACAAAAT TCGTATGGGACGATAAAATTAACCTCATCCAATTATTCTATTTGGAGGTGCAAAATGCAAGATTTGCTTATTGTCAAATA TTTGTTTGGGCCTGTTATGGGCAAGTTAAAGCCATAAAAAATAAGTTATGGTGATTGGAAAATATTGCTTATGAAAGCTG CTGCTACAATTAGGCAATGGGTTGATATTAATATTTTCCACCGATTGGTGTTTCAAATCCAATGGCTTATCGAAATAGGA AGGGTGTGAACTCTCAGAATATATTGGCAGCCTGCTCATTCGATATGAAGTTCACTTAGTTGCTATCTGGTTGGGAAGGT TCAGTACACGATGCATGAGTGCTCTCAGATGCGCTCGACAATCCTAGGTTTAAGTTCCCACGTCCCCTACTAGGTTATAC TTCATAATGTCTTCCTACTCATGGCTATTTATTAATTTGGGGCCTAAATTGCATCCTAATTTAGATAAGTTGCGCAAGAA AATACTATCTTGTTGATGCGGCCTATGCGGACAATGATTATTTTTCGCTCACTACAGAGGTGGGTCTTACTATTTGCCTG ATTACAGAAGGAGAAATGGTGGATTTCAGGGACCTAGAGATATTTTAAACTACAAACACTCATCGCAGCGAAATTGTATA GAGAGAACATTTAGAGTTTGGAAGGCTAGGTTCCCTCTCCTAAGGCGCCCCAATAATACTTATCCAATGAATAAACAAGT GACAATTCCAGTGGCTTGTGCAATACTATATAATTTCATTCACATGGTTAATAAGGGGGACCTGCTTCTAAATCAGTACT ACCGTGATGGTGTACTGATAAGTGAAATAGATTCAAACAGTGATGATGAATTTGATGACGATCAAAATGATGGCAATATC CTTGAGGGACCAGATGTAACAGCATGTAGTGTTAGCCATACAGAGATTGGTCATGAAATGTGGGTGGAATACCAGGGAAG CTGTGAGAGACAAGTTTGAAAGTGCATAATGGGATTCTACCTCTATTACTTGAATATAAATTATCTCTATCAACTTCATA TTCATGTATCCATTATATTCAAAAAATTTTTGACATTCGTTACGTACGTTTATATCATGTGAACTAATTTCTCTTTTCAA CCTGAATGACTGTTACTTGCCTTCCTTTTCGGCTACTAGCATAATTTTTTGCATTTATTTCTCTTTTAACTTATTATAAT TTTGAGTTAAAATTTTTTTCTAATATTTTATTTTTTTAATTATATAACGAATTATATTTCTTTAATTACACCTAACGTGA TTTACACGGCCAAAAGTTGGTTCTTGTGTTGGTCACGGTTCAAAATTAGAAAACAAGACAACTAAACACTAGTTCGAATC ACATTTCTGGTTAGAATTAGAATCATGCTTATATACACCTAAATAAAAGTTCCAATTACCATAAATCGTGATTCTGAATC TAAAAACCCAAACCACGCCGATTCCAATCCTTATACCAAACGTGTCCTAAGTGAATTTTTATTATTTTTGTACTTTATCT TTCAAAAGGTTTAACATCCTACGCATAGAAAAAGTGAAATCTAAATCTAAATTATTATTCTCATAATAAATGACGAAGCA ATTTAAATTGTGGGAGTATGATTGAATAAAAAATAAGTTCTACGGAATAGATATATCAATTACGAATATAATTCTGACTT AAAATTAGAGACTTTCTC