>DTH_13_1_Mno length=7041;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; GGGGGCGTTTGGTATAAGATAATTTCAAAGGTAGGAATGAAAATCTTACAAATTCTCATATTTGATATAATTATTAGATT TTTTTAAAACCTAAAAAAATAAAAATTATGAGTTTCACATTACTACATTTTGGGGTAATCATAAACCCATCTAGGAGGGT GTTATTTACTTTCTCAAGAAAGTTTAATATCACATGAAAAGAAATAAGTCCTAACCTCTCTCTCAGACTCTCACCCTTCT CTTCCCAGCCCAGCCTCCTCTCTCTCGTCCAGTCTGGCACCACTCTTCTATCGACTACGCCGTTGCCGGACTTTTCTGTG CCGCCACCACCAGGGTATGTTATTTTCTTGGTTTTTCTTCTTTTCTTCTTGTTGAATCCGTATCAGCCTTTTTTTTTTAT CCCCAAATTCATAACAAATTTAACATTATCTGATGAAGATATAATGTAGTTATCAAATTGTCCTCAAAAGTTGCAGCATT TTTCTTTAGCACATGAAAACGAGCTATTTTAAAGACGAACCCAAAAAAATTATATCAGATCTACTTAAAAGTTGAAACCT TTTCAGCGAAAAAAGATCTAGCAAATTAAAGAAAATTTAGAGCACAATTTTTGAAACTAGAGATCTCGGTGAAGAAGAGG AATTTGTCTTTGTTTAGGACAAAAGCACGTTTTTACAACAACCCATCGTACAAAATTCCAAATCTTGATAAGTTCTGAGC TTTCTCAGCAACCAAACATACCCAAGAACATTATCAAGAAAACCCACAGATAGAAAGGGAAAAAAAAAAACACAGAGAAG AGAGAGAAAATAACTTAACACTCAACAGACAAACTAGGAGTTACTGACTAAGAAGAGGTAGACATTGGAGCTCAAGAAAA GCAGCTTCCTTAGATCACAATGCCATGGTTATGGTTCAGAGCAAGAAAAAAAGAAAAAAAAAAAGAAAAAGAAAAAAAGA GAGAAAATAGCTCTATTTTTCTTGTTGAATCCGTTAATGATGTCGTTGCCTTTGGTTGAATCTATATCTTATTGAATCCG TTAATGATGGCCATTGCCTTTGGTTGAATATATTTCTTGTTGAATCCGTTATATACGTGGCTGAATTTTTTCTTTATAAT CAGTATGTTTATTTCTTTTTTCTCCATCAATGAGCAGATATGAATCTTCTTCCATTGGAACGAAAAAAAAAAAGAATTGT GGCTATTTTGGTTCAATATATGGAGATGTTAAATGAAATGACATTTTTGTTCTATGATATTTGTAATTATTAGTAAGAGA CATTTGCGTAGAAATAGATGGGGTGAGAGTTCTTATCGCCGACATCATATACGCCAACTAAATTACCATCGATTGATACA TGAGAGTGACTTAGTATGTCTTGAAAGCACTCGTATGGATAGGAGAACATTTACTATCCTATGTAACTACCTTAGAACTA TTGGTCATTTGAGGGGAACAAAAAATATAGATGTTGAAGAATTGGTAGCTATATTCCTACATATATTAGCTCATGATAAA AAAAAATAGGATTATGAAATGCCTATTTGCATCTCAGGTAACCAATTTGACTTCATGCCAGGCAGATCAACCACGGAAGC CATTTTTCTTCTTAGGATGCTGGTGGAAAGGTACAGAGAAGTCAAGACGGACCTACATATGGTTTGTATAAATTTAGGAA AAGCATATGATAGGGTGCCGATGGAAGTTTTATGGTGGGCGTTAGAAAAGAGAGGAGTGCATGTGAGGTATATTAAGGTA ATTAAGGACATGTACGATGGGGTGGTCACGAGTGTGAGAACTGCTGGAGGCTACACGATAGAGCTCTCTCTCGTCCAGTC TGGCACCACTCTTCTATCGACTACGCCGTTGCCGGACTTTTCTGTGCCGCCACCACCAGGGTATGTTATTTTCTTGGTTT TTCTTCTTTTCTTCTTGTTGAATCCGTATCAGCCTTTTTTTTTTATCCCCAAATTCATAACAAATTTAACATTATCTGAT GAAGATATAATGTAGTTATCAAATTGTCCTCAAAAGTTGCAGCATTTTTCTTTAGCACATGAAAACGAGCTATTTTAAAG ACGAACCCAAAAAAATTATATCAGATCTACTTAAAAGTTGAAACCTTTTCAGCGAAAAAAGATCTAGCAAATTAAAGAAA ATTTAGAGCACAATTTTTGAAACTAGAGATCTCGGTGAAGAAGAGGAATTTGTCTTTGTTTAGGACAAAAGCACGTTTTT ACAACAACCCATCGTACAAAATTCCAAATCTTGATAAGTTCTGAGCTTTCTCAGCAACCAAACATACCCAAGAACATTAT CAAGAAAACCCACAGATAGAAAGGGAAAAAAAAAAACACAGAGAAGAGAGAGAAAATAACTTAACACTCAACAGACAAAC TAGGAGTTACTGACTAAGAAGAGGTAGACATTGGAGCTCAAGAAAAGCAGCTTCCTTAGATCACAATGCCATGGTTATGG TTCAGAGCAAGAAAAAAAGAAAAAAAAAAAGAAAAAGAAAAAAAGAGAGAAAATAGCTCTATTTTTCTTGTTGAATCCGT TAATGATGTCGTTGCCTTTGGTTGAATCTATATCTTATTGAATCCGTTAATGATGGCCATTGCCTTTGGTTGAATATATT TCTTGTTGAATCCGTTATATACGTGGCTGAATTTTTTCTTTATAATCAGTATGTTTATTTCTTTTTTCTCCATCAATGAG CAGATATGAATCTTCTTCCATTGGAACGAAAAAAAAAAAGAATTGTGGCTATTTTGGTTCAATATATGGAGATGTTAAAT GAAATGACATTTTTGTTCTATGATATTTGTAATTATTAGTAAGAGACATTTGCGTAGAAATAGATGGGGTGAGAGTTCTT ATCGCCGACATCATATACGCCAACTAAATTACCATCGATTGATACATGAGAGTGACTTAGTATGTCTTGAAAGCACTCGT ATGGATAGGAGAACATTTACTATCCTATGTAACTACCTTAGAACTATTGGTCATTTGAGGGGAACAAAAAATATAGATGT TGAAGAATTGGTAGCTATATTCCTACATATATTAGCTCATGATAAAAAAAAATAGGATTATGAAATGCCTATTTGCATCT CAGGTAACCAATTTGACTTCATGCCAGGCAGATCAACCACGGAAGCCATTTTTCTTCTTAGGATGCTGGTGGAAAGGTAC AGAGAAGTCAAGACGGACCTACATATGGTTTGTATAAATTTAGGAAAAGCATATGATAGGGTGCCGATGGAAGTTTTATG GTGGGCGTTAGAAAAGAGAGGAGTGCATGTGAGGTATATTAAGGTAATTAAGGACATGTACGATGGGGTGGTCACGAGTG TGAGAACTGCTGGAGGCTACACGATAGAGTTCCCCATTCGGATCGGCCTTTATCAAGGATCTGCTCTTAGTCCGTATCTT TTCACCATCGTGATGGATGAGCTGACAAGAGAAATCCAAGATAGAGTTCATTGGTGTATGCTTTTTGCGGATGATATAGT TTTAGTTGATGAACTCACCGTAAGTTAGAACTGTGGAGATAAACTCTCGAGACGAAGGGATTTAAGTTAAGTAGGACGAA AACTGAATACATGCATTGTAGGTTTAGTAACTCAAGTAATCAGAGTGATGGAATGACTTTAGATGGTGTGGAGATTGAGG CTTCTAGGAAGTTTAGGTACCTTGGGTCTATAGTGCAGTACGAAGGAGATATAGAAGAGGATATTCAACATAGGATTAAG GCAGGGTGGGTTAAGTGGAAGAATACTGTGGGAGTTTTATGTGATGGCAAGATGCCTATTAAGTTGAAAGGAAAGTTCTA TAGGACTGTAATCCGCCCAGCTGTGTTATATGGCAGTGAATGTTGGGCCATTAAGAGACAACATATATCTAAGATGAGTG TGGCAGAAATGCGTATGTTAAGATGGATGAGTGGTCATACGAGAATGGATCGCATAAGGAATGAAGTTATTTGTAGTAAA GTAGGTGTAGCACCAATAGAAGATAAGGTGTGCGAAGGCCGCTTGAGGTGGTTCAGGCATGTCCAACGTAGACCGCTAGA AGCACCAGTTCGTGCTTGGAAGGACATTCTTATACCTAATACTATGAGAGGGAGAAGTAGACCAAGAATTACATGGACCG AAGTCGTTAGGAAAGACATTCTAGATCTAGGCCTTCAGGAAAGTTTAATTTTGAACAGAGCTGTGTGGAAAAGTGAAATC CATATAGCCGACCCCAATTAAGTTGGGATTAAGGTTTGTTGTTGTTGTTGTTGTTGTTGTTGTATGAAACGTCTATTTGC ACGCTCGGGTGAAACAATAAGTAGACAATTCAATATTGTCTTAAAAGCGGTGTTACTCCTCCATGAAATATTACGAAAAA GGCCAGAGCCAATTCCAGAAAATTCTACGGATGAAAGATGGAAATGGTTTAAGGTGAAAATTTTAAATATCAATTAATTT TTTATTATTTGTATGTTAATATGCAGTAGGTATGTAGGCTTAAATTAATATTTGTATTTTAGAACTGTTTGGGAGCACTT GATGGAACATACATCAAGGTCAATGTGTCTGCAGCGGACACGCCTAGGTACCATTCTAGAAAGGGTGAAATTGCTACCAA CATGTTAGGAGTATGCTCTCAAGATATGCAAATTATTTATGTATTGCCCGGATGGGAGGGTTTCGCATCTGACTCAAGAG TTTTGTGAGATGCTTTATCTAGGAGGAATGGATTGAAAGTTCCACATGGTAAATATGTATCTTCTTGACAGTTAGAGTCA TACACATTCAAATGTGTATGCATTTTAATATTTTCTAATATATATCGAAATGATTTACATGATATTACTACCTATACGAT GCTGGTTAACCTAACGGTGAAGGCTTTTTGGTTCCTTATAGAGGACAACGCTACCATTTAAATAAATGGATATACCCACC TGAGACTCCTGAAGAGTTTTTTAACATGAAACATTCCTTCACTAGGAACGTTATTGAGAGGACATTTAGACTTTTGACGG GGCAATGGTCAATTCTTAGGGAAAAATCATTCTATTTTATCAATGCACAATGTAGGATTATTGCGGCATGTTGTCTTCTT TACAACTTAATTAGGAGGGAAAAAGAAGAAGAAGAATAGGAGGATGATGATGAAGACGAAATAGAGCATTACACACATAT TGAAACATCCAATGCTTGGACTGTATGGAGAAATAATTTGGCTAGGGAAATGTTTGACCAATGGCGGGGAAATTGCCATT GATATGGATTATTGTTGTACTTGGATTTTTGTTTTGATCCTTAATAAATATGTATGCCATGGTTGTTGTGACTCTTAATA AATGTGTGACATTGTTGTTATGATTCTTAATAAAGATATATTGATGTGTTGATTTGTTTTGTCTAGTATTGTTAGTTTTG TTTTCATATTAAAGTTTATAATTTGTACACAGAATGGATGCCAATGGAAAGAAGCATCAATGGACTGCATTGGAAGATTC AAAGCTAGTGAAGTGCTTGTTGGATATGGCTAATAGTGAAAAATAGAAAGCGGATAATTGTACTTTCAAGCCCGGTTACT TGCAACAATTGGAGAAAATGATGAATGAAAAGATTCCGCAATGTGGGCTTAAAGCACAACCCCACATTGATTCTCGTGTA AAGATATTGAAGACACAATATCATGCCATTTCTGAAATGTTGGGCAGTGGCTTTGGTTGGAATGATACGGATAAATGCGT TATGGTTGAGAAAAATGTGTTTGATGAGTGGGTTAAGGTTAGTATTTTTTTAACTGGTTATAAATTTCAAGTTTCAATAT ATTAGGCTCTTTTATTGTTTAACTTACCTTCCATATCTATTACAGAGTCACCTAACTGCAAAAGGCTTAAGAAACAAGCT GTTTTCTTATTATGATGAGTTAGCACTTGTGTTTAGAAAGGATCGTGCTAATGGACAAGGTGCAAATGAGATTGCATGAT ATGGTTGATGATATTGATAAAAAAATAAAAAAATGATCTTGATTATGATCCCTTGCTTATGTCTGATGAGCACATGGATA CTACAAGTATTGGTGGTCCTAGCACACAATTAACTTCAACACCATTTACATCAGGAAGAAAAAAGAGAAAGAGATCTCAA AATGGAGATGTATTGGTTGATGCTTTAACTGAGACAGTAAAAAAGTTTTCTAATATGTATGCTATGGCTGGTGAGAATAT TGGTAGGCTTGCTAATTGCTTTCAATACGAGGTTGATAGTGCTGCAAGGAGGTTGATAGTGCTGCAAGGAGGATGAATGT GTTTGTTGAAGTGAAGAAGGTAGAAGGACTAACAAGTGCACAATGAGTACGAGTTGGAAAACTTTGCGCCCAAAACCATG ACAACACTAAGTATTTCTTCACGTTGGATGAGGAATTTACGTTAGATTTCCTTCTATCTCTTTTGGAATGAGTTGGGTTG AAGCTTTTGGTGTTATATTTACAAACTTTAGTATATGGTCTAATATTTAGATCTTTTGATGGCATGTTTAGAACCTTTAT ATGTGGTCCTATATTTACAACTTTTGATGATAGGTTTGGAACTTTATTGGAATATATGGTCTCATGTTTAGAACTTTTGT AAGAACTTTTGAGTATAGAGGATTTTAGCTAACATTTTGAGACCCCTATTATTTAATAATTTATGGATTACTTGTTGTGT TTTGAGGGTAAATATTTATAAAATATAATTTTATTTTATACTTTTTAAAATATTAGTGCTAATATTATGGGCTAAATATT TTAAAAAATATAATATTATGTTATTAAGATACATGAGTGTTAATTGCAATTTATTTTAAAAAATATGTTTTTTTAATAGA CAACATTTTCATGCACAATCAAACACAATAATGTATTATTTCTGAGAATTTGAGACAAGATTCATGTATGGAACTAATGT ATAATTTCTGAGAATCATATTACCCCTCATCACTTTCTTAAGAATATGATTCACATTGATTACTGTGTACCAAACGCCCC C