>DTH_12_1_Mno length=2510;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; ATTTTGGGGTAATTCTAAACCCACCCAACAGGGTGTTATTTACTTTCCCAGGAAAGTAATATTCACGGGAAACCTCTCTC TCGTCCATTTCTCTCACCCACCATCTCATCCATCTCTCTCTCTCGACCATTTCTCTCACCCACCTATCTCATCCATCTTT CTCTCTCTCTCGTCCAGATCCAACCTCTCTCTCGTCCAGACCTAGCACCGCTTCCGTCGAGGACGCCGCCGCCGCCGCCT TCTGATCCACCACGCCGTTGCCGGACTTTCCTCTGCCGCCACCACCAGAGTATGATTCCTTTTTTTATCCTTTTTCTGTG AAAAATTTTTGATCTGAACTTTCTGATTTGAACGTCGTCGGCATCGGCGCATCTGGGTTTGAACCAGAGCAGCCACGATT TCAAAAATCCTTTTTTGGCCACAATTTCTGGCGCTGGGTTTCTGAATTTGTGTGTTTTTCATCCTTTTTTGGCCACGATT TCTAGCGATGGGTTTCTGGATTTGTATATGAGTATGTTGAAAACCGTACATAGCATTTACAAATGCCTTGCCTTTTTTAA ACCGAATCTTTAGAGTCAAAATGAGAGTGACTTAGCATGTCTTGAAATCACTCGTATGAATAGGAGAACATTTACTATCC TATGTAACTACCTTAGAACCATTGGCAATTTGAGGGGAACAAAAAATATGGATGTTGAAGAATTGGTAGCTATATTCCTA CATATATTAGCTCATGATCAAAAAAATAGGATTATGAAACGCCTATTTGCACGCTCGGGTGAAACAATAAGTAGACAATT CAATATTGTCTTAAAAGCGGTGTTACGTCTCCATGAAGTATTGCTATAAAAGCCAGAGCCAGTTCAAGAAACTTCCACAG ACGAAAGGTGGAAATGGTTTAAGGTGAAAATTTTAAATATCTCTAATTCTTTATTATTTGTATGTTAATATGTTGTAGGT ATGTGGGCTAAAATTATTATTTGTGTTTTAGAACTGTTTGGGAGCACTTGATGGAACATACATCAAGGTCAATGTGTCTA CATCGGACGCGCCTAGGTACCATTCTAGAAATGGTGAAATTGCTACCAACATGTTGGGAGTATGCTCTCAAGATATGCAA TTTATATATGTATTGCCCGGATGGGAGGGTTCCGCAGCTGACTCAAGAGTTTTACGAGATGCTTTATCTAGGAGGAATGG GTTGAAAGTTCCACAAGGTAAATATGTATCTTCTTGACAGTTATAGAGTCGTACACATTAAAATGTGTATGCATTTTAAT TTTTCTAATATATATTGAAATGATTTACAGGATATTACTACTTATGCGATGCTGGTTATCCTAATGGTGAAGGCTTTTTG GCTCCTTATAGAGGACAACACTACCATTTAAATACATGGACGTACCCTCCTGAGACTCCTGAAGAGTTTTTTAACATGAA ACATTCATCGGCTAGGAATGTTATTGAGAGGACATTTGGACTTTTGAAGGGGTGATGGTCAATTCTTAGGGGAAAATCAT TCTATCCGATCAATGTACAATGTAGGATTATTGCCGCATGTTGTCTTCTTCACAACTTAATTAGGAGGGAAATGGCTATT GATCCTTATGAAAGACAATTGGAAGTAGAAGAAGGAGAAGAAGAGGATAGTGAACAAGAAGTAGAGCATTACACACATAT TGAAACATCCAATGCTTGGACTGTATGGAGAAATAACATGGCTAGGGAAATGTTTGACCAATGGCGGGGAAATCACCATT GATATGGTTTTTGTATGACATTGTTGTTGTGATTCATAATAAATTTGTATGACATTGTTGTTGTGATTCATAATAATATG TATGACATTGTTGTTGTGATTCATAATAAATTTGTATGACATTGTTGTTGTGATTCATAATAAATATGTATGACATTACT ATTGTGTACACAGAATGGATGCTAATGTAAGGAAGCATCAATGGACTACATTGGAAGATTCAAAGCTAGTAGAGTGCTTA TTGGATATGGCTAATAGTGGAAAATGGAAAGCAGATAATGGTACGTTCAAGCCTGGTTACTTACAACAATTGGAGAAAAT GATGAATGAAAAGATTCCACAATGTGGGCTTAAAGCACAACCACACATTGATTCTCGTGTGAAGATATTGAAGAAACAAT ATCATGCTATTTCTGAAATGTTAGGCCCTGCCGGTAGTGGCTTTGGTTGGAATGATAAGGATAAATGCGTTGTGGTTGAG AAAGATGTGTTCGATGAGTGGGTTAAGGTTAGTATTTTTTTATCCGGTTATAAATTTCAAGTTTTAGTATTATTAGGCTC TTTTATTATTTAATTTACATTCCATTTATATTACAGAGTCACCCATCTGTGAAAGGCTTAAGAAACAAGTCGTTTCCTTA TTATGATGAGTTAGGACTAGTGTTTGGAAAGGATCGCGCTAATGGACAAGGTGCAATGGGATTGACTGATATGGTTGATG ACATTGATAAAGAAACAGAAAATGATATTG