>DTH_11_1_Mno length=2511;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; AATGGGAATGACATGTATTAGTAATGTTCTAATTAAAGATTCTGAACTTTCATTAGATTTATTATGAATAATGTTTTTGA TTATTATCCTTAAACACTATCCTCTCGTATATAACACTTATATACTATGTTTAAGGTTACATAAATAATCACGGAATTTT CATTTGATATTCATAAAATATATGCACATAAAATGATGAATAAACTCTTTTATTAAATAAATAATAAATATCATATTACA TCTCATGCTTTTAGGACACTATTCCCAACAACAACATGGTATGAACGCACAAGAAGTGGAAACATCCGAAATGGGTGGTC GGCTACAACGTAATCACATGGTTAATTTTATGGATTATCTAGCTGATCAAATGTGGGATTCGTATATACGACAGTAATAT AAGCTAAGATTATTCACTAAGTAATTTTTTTTTTTTTACTAATCAATCACTAAGTTATCTTATTTTAAATTATTTACTAT TTATTTGTAATGTAATTTAAATTATTTTATTAATTATTAGTGTTTTTATTTGGGATTCAATTATTATTTATTTAATATAT TATTATTTTAAATACTATTACATGTTTTCAAAAATTAAACCACCAAACACAATTTCAGTTTTTTTTTTAAACTGAAATCA ATCTCTGAATAAAACTACCAAATGCATTTTCAGAAATAATTCCAAAATGAAAATGAAAACATTTTCATTTCCCTTTTCAT ATAGAAAACAAAATTATTTTTGAATGAGTTCCAAACGCACCCTGTATATCAGTGGTTCTCAAAGGTGTTACAAACTATAT GCCGTTTGTGTCATGACTTTATAGAGGCCCCCAACTACGATAAAGTTCAGCCGTTCATATCGGACAATGCTCATAAATAT TGTCCTTGGTTTGACGTAAGTACTCCTTTGCTTGTCTAGTTTGATTTTCTCAATTTTTGCTCCGACTCTTTTATAGTTAT TCGTAACGTTTGTTTATTATTTATCCTGCGGAATTGTGTAGGGGCAATTGACAGCACTCACATACCATGTGTCCCACCAA GCGAAAGAGTTGGAATTTGGCGTAACAGAATGGGGTTTTACTCTATGAATATCATGGCAGCATGCTCTTTTGATATGAAG TTCACATATATCTTATCTAGTTGGGAGGGATCTGCGCATGATGCGCGAGTGCTTCAAAGTGTTGTTTGGGACCCGGCAAA AGATTTTCCACGTCCACCTGAAGGTTTTTCTCGCAAGCTAGTAATAGTAATGACAAATAATATACAAGTTCAAAACTTAT CCATCTTATTTATTTTGTCCAGGTAAATTCTACCTAGGCAATTTTGCATATGCAAACAACGATTGTTTCCTGACTCCATA TCGAAAAACCACTTACCATTTGCAAGATTACAAGGTTCAATGTGATGGTCTTACTTCACAACGGGAGTTGTTTAACTACA CACACTCCTTATTGAGAAATTGTATTGAGAAGACTTTCAAAATATGGAAGGCAAGGTTCCCTATACTAAAACGAGCAAAT AGTTATCCAATAGAGAAGCAAGTGAGGGATTCCGGTGGCATGCGCAGTCTTGCACAATTTCGTCCTTACGGTTAACGAAA GGGATGAGCTTTTGCAGCGATACTTTCGCGATGGAGTGCCGGATTCAGATATGGACCTTGAGAATGCATATCCTATCAAT TATGACGTCGGTGCAAATAATGTTTTTCCTCATGGTCCCGCTGTGTGTCGCAACAGAGCTGACCGCGTAGACATGAATCG ATTCAGGGATCACTTGGCAGACCAAATGTGGGCAGCCTACACACACCCCGCTCGTGATATAGGTAGCACTTACATTTGTA TACGGAACTTTAAGGCAAGATATATGTACATATATATTTTTTTGAGTTGTACTTGAATTCTAGTATGGACAGAACTATAA ACGTACCCTTTTGTGGATTTCAAAACTATATGGGTGGAAAACGAAATGGTTGCAACGAAGTTAAACTCGCCTTCATAATT CAACTCTTCCTAGTTCCTATTATAATTTGATTTGTTTGGTTATTTTTCTTCCCTTTTTTTTTCTTCTTTTCCTATGATCT TTCCTTTTTAACTTTTAGTGATTTTACAATGATAATTTTTACACATTCTTATAAACGTACCCAAAAAAGTCTTTTCTATT ATGCTTTTGATAAAGATAAAATTTTTTATACGTTTTTATATATTTATAATTTTAACACTCTTCTACTCCTTGACAGTTGA CACAGCGGCAACGACAAAGCTGTCGCCTCCCCAAAATATTTCCCCTATATCCCATAGATCTCTCAGATCTTCAAGCTTTT TTTTTTTGGAAAGGAATTCAGCAAAATCTCATCAAGTTAAAGAATATATCACATCCACATTTCTCGTTGAAAAATTGGCA ATGCAAAATAAATCAAACTCCACAAACATGAATTCTATGAAACTAGTGTTTCTCGAACTCTCCCTTTTTCATTCATCTCT TTATTATTATTATTATTATTATCTGGTGAAA