>DTH_10_1_Mno length=2516;Class=DNA transposons;Order=TIR;superfamily=PIF-Harbinger; AAGAGTTAAGTTATATTAAATGGTCGATTTTCTCTTAATATTGGACCACGGATTAGTGTTTAGTACTATGTTGTTGAGTG TAAACCTTATTTCAAGTGATGTAAAACAATTTTCATTCTTTGTTGGTGTACTGATTTACATTCTTTCTTTGATGTATGAG ACTGTATTGGTGTGTGCTATGTACATTTTTAAGAAAAATATGTTTGAGATGAAACAACAACATGAACAATAACAATTGGA GGAAAGATTGTTGCTAAGTACAAAAAGGTAGATAAATTAACAACATACTAATAATATTAATAAACAAATTAAATGAAAGA GAATAACCGTTGACATATGTTAAAGTGTGAACTAACTAGATGCAGCGTGAAAATGAGGAACGAGATAGAAGAACGTCTTC AAGACGCCGGCGTTGATTTATGGCCGCAATAGGTGCAACCACAGCTGCAGCTGTTTATTTGTCTAATGACAGAGTAAGAA GGCCGATGCACATTTCTTTTTTAAGGGGCATGGACAAGGTAAATGAGCTAAGTAAACAATAATAAGACTGCAATATTTAA CAAGGTGCGTATGGGACTGCGTGATTTTATGATTCTTTGTGAAATACTAATTGAGAGATGCTTGTTACAACCCTCACATA ACATGAGCGTACCTGAACAATTATTTGTGTTCTTAACAATCGTTTCACAAAGTCAAAGTAATCGTGAATCACAAGACGCA TGGCAACATTCTGGGGAGACCATATCACGCCGGTTTACTAAAGTTTTATATGCTATATATGCACTACATAATGATTTCAT TAAGCCCCCAAACTATGACAAAGTTCATGAATTTTTACGTGCCAACCGTTAGAGATATGATACATGGTTCGATGTAAGTT GTGTTACTCTTTTACATCTAATTTTTTAACTATCATTGGTCTTCTTAATAATAAGTCGATAAATATGTTTATATGATACT TATGTGTAAAACTTTTACTTGAAATGGTCTGGATTGTGTAGGTGCAATTGATGCTACTCATGTACCTCGTACACCGATTG GTGCTCATAATCCAATGGCTTATCAAAATAGAAAGGGTGTGAACTCCCATACCATATTGGCAGCCTGCTCCTTTGATATG AAGTTCACATACATATTATCCGGTTAGGAAAGTTCAGCCCACGATGCTCGAGTGCTCGCAGATGCGCTAGACAATCCTAG GTTTCAGTTCCCACGTCCCCCACCAGGTTACACTTCACAATGTCTTCCTACTTAAGGCTATTTATTATTATGGGCCCTCA ATTGCAGCCTAGTTTGGATATGTTACACAGAAAACTACTATCTTGTTGATGCGGCGTATGCCAATGATTGTTTTCTCGCT TTGTACAGAGGTGAGACTTACCATTTGCCTGATTACAGAAGGAGAAGTGGTGGATTCTAAGGACCTAGAGATATTTTTAA CTACAAACACTCATCATTGATAAATTGTATAAAGGGAACATTTAAGGTTTGGAAGGCTAGGTTCCTTATCCTAAGGCGGT GTAATAAGACATATCCAATGAATAAACAAGTGAAGATTACAGTTGCATGTGCATACTACATAATTTCATTCACATGGTTA ATGAGGGTGATAAGTGCGCGAATTTGCACTTTTAATAATCATAATTGTCAAATTATTTTATCAAATTTGTGATTATAATT TCAAATATTCCTAAATCTAGAGGATTTAATTTTAATTAGATTTATTTTATTTTTTAGGTTTTTGAAGAAACCAATTGGAT TTGGGCTAGTTTACCAAGCAAAACCCAAAAGTTGAGCCCAAGAAAAGCCCAATTCGGCCCAAAAGCCGAGAAGCCACGAG CTGAGCCAATAAGCCGCGAGCCAACCCAGTGCCACGTGTCGACCACTGCCGCACCGCAGTCCGTGGGACCCAACTGTCCC CGCGGATACGCGCGCTTGGCGCGCACGGATCCTCTCCCCGGGCGACTCTCCTCCACGCGCGTGTCACCCAGATTTCCTAT TTCTTCCGTGTAGGTCCCGCGTTCCAGCTTCCCTCCAGCCAGGTCTCGCCACGCGTCCCAGAGGGGCCCAGCTGCTCCCC CGCGTACGCGCGATTCACGCGCACGTTCCCTCCCCGCGCGAGTTCTCCTCCATGCGCGCGTCCAGTCTCCCTCCGCGTGG TCCAGCTGTGCACCGCGTCTCTCCTGTGCACGAATCATGTTGCGACACGTGTCCCACTCTTCAGAAACGTGATGGTTTTT CTCCCTCGATTAAGCCTTGTAACTTCTTAATTATGATCCAGTTTTTAGCTTTTTAGCATTCTCAAAACTCTATAAATAGG GCCATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN