>DTH_1N_1_Mno length=165;Class=DNA transposons;Order=MITE;superfamily=MITE; GGCCTCGTTCATTTCACCGATTCGAGTTTTCAATTTCAATTTTGCTACAGTTAAAAGCTCTCACAAAAAGTCACATCTAA CTTTTTCTGCTACAGTAAAAAGCTCTCACATAAAATCACATCTCAACTCAAATTAAAAACTCGAATCAACGAACTGAACG AGGCC >DTH_1N_10_Mno length=223;Class=DNA transposons;Order=MITE;superfamily=MITE; TAAGGCCTCGTTCATTTCACTGATTCGAGTTTAGAATTTGAGTTTTGTTACAGTAAAAAGCTCTCACAAACAATCACATT TAGGCCTCGTTCACTTCGCTGATTCGAGTTTTTAATTCGAGTTGAGATGTGATTTTATGTGAGAGCTTTTTACTGTAGCA AAAAAGTTAGATGTGACTGTTTGTGAGAGCTTTTTACTGTAGCAAAACTCGAATTCTAAACTC >DTH_1N_11_Mno length=170;Class=DNA transposons;Order=MITE;superfamily=MITE; CCGATTCGAGTTTAGAATTTGAGTTTTGTTACAGTAAAAAGCTCTCAGAAACAGTCACATCTAACTTTTTTGCTACAGTA AAAAGCTCTCACATAAAATCACATCTCAACTCGAATTACAAACTCGAATCAGCGAAGTGAACGGGCCCTAAATTTTTTTT TTTAAATAAC >DTH_1N_12_Mno length=206;Class=DNA transposons;Order=MITE;superfamily=MITE; CGTTTAGTTCGCTGATTCGAGTTTTTAATTCGAGTTGAGATGTGATTTTATGTGAGAGCTTTTTACTGTAGCAAAAAAGT TAGATGTGACTGTTTCTGAGAGCTTTTTACTGTAGCAAAACTCGAATCGGTGAAATGAACGGGGCCTAAATATATTTTTA TTAGAATTTAAATTTTAATATATATTTAATAACTTAAATGGTTTTT >DTH_1N_13_Mno length=303;Class=DNA transposons;Order=MITE;superfamily=MITE; CGAGTTTTTAATTCGAGTTGAGATGTGATTTTATGTGAGAGCTTTTTACTGTAGTAAAAAAGTTAGATGTGACTGTTTCT GAGAGCTTTTTACTGTAGCAAAACTCGAATTCTAAACTCGAATCAGTGAAATGAACGGGGCCTTAATTTAATTAAATTAA AAAGGCCCCGTTCATTTCACCGATTCGAGTTTTGCTACAGTAAAAAGCTCTCAGAAACAGTCACATCTAACTTTTTTGCT ACAGTAAAAAGCTCTCACATAAAATCACATCTCAACTCGAATTAAAAACTCGAATCAACGAAC >DTH_1N_14_Mno length=146;Class=DNA transposons;Order=MITE;superfamily=MITE; CGCTGATTCGAGTTTTAATTCGAGTTGAGATGTGATTTTGTGTGAGAGCTTTTTACTGTAGCAAAAAAGTTAGATGTGAC TGTTTCTGAGAGCTTTTTACTGTAGCAAAACTCGAATTCTAAACTCGAATCAGCGAAATGAACGGG >DTH_1N_15_Mno length=251;Class=DNA transposons;Order=MITE;superfamily=MITE; ATTTGAGTTGAGATGTGACTTTATGTGAGAGTTTTTTACTGTAGCAAAAAAGTTAGATGTGACTGTTTCTGAGAGCTTTT TACTGTAGAAATAATAAACTCGAATCGTAAATAACGTTATTCGCTGATTCGAGTTTTTAATTCGAGTTGAGATGTGATTT TATGTGAGAGCTTTTTACTGTAGCAAAAAAGTTAGATGTGACTGTTTCTGAGAGCTTTTTACTGTAGTAAAACTCAAATT CTAAACTCGAA >DTH_1N_16_Mno length=136;Class=DNA transposons;Order=MITE;superfamily=MITE; CCCGTTCACTTCGCTGATTCGAGTTTGTAATTCGAGTTGAGATGTGATTTTATGTGAGAGCTTTTTACTGTAGCAAAAAA GTTAGATGTGATTGTTTGTGAGAGCTTTTTACTGTAGCAAAACTCGAATTCTAAAC >DTH_1N_17_Mno length=126;Class=DNA transposons;Order=MITE;superfamily=MITE; TTCGAGTTTAGAATTCGAGTTTTGCTACAGTAAAAAGCTCTCACAAACAATCACATCTAACTTTTTTGCTACAGTAAAAA GCTCTCACATAAAATCACATCTCAACTCGAATTAAAAACTCGAATC >DTH_1N_18_Mno length=330;Class=DNA transposons;Order=MITE;superfamily=MITE; TTAGAGCCCGTTTAGTTTTAATTTAAATTTTTAATTCGAGTTAAAATATAATTTTATGTGAAAGTTTTTTATTGTAATAA AAAAGTTAAATGTGATTATTTCTGAGAGCTTTTTACTGTAGCAAAACTCGAATCGGTGAAATGAACGGGGCCTAGAAATA AATATATTAGCCGTTCATTTCACCAATTTGAGTTTAGAATTCGAGTTTTATTACAGTAAAAAACTCTCATAAAAAGTCAC ATATAACTTTTTTATTACAATAAAAAGCTCTCACATAAATAACATCTCAACTCAAATTAAAAACTCAAATCAGCGAACTA AACGAGCTTT >DTH_1N_19_Mno length=144;Class=DNA transposons;Order=MITE;superfamily=MITE; ACTTCGCAGATTTGAGTTTTTAATTCGAGTTGAGATGTGATATTTTTTGAGAGCTTTTTACTGTAGCAGAAAAAGTTAGA TGTGACATTTTCTGAGAGTTTTTTACTGTAAAAATTTAAAACTGAAAACTCAAATCGGTGAAAT >DTH_1N_2_Mno length=536;Class=DNA transposons;Order=MITE;superfamily=MITE; GGGCTTGTTCTTTTAGAGTAAAACTCAAAAAAAATTTGAACTCAAGTTACAACTTTATTCAAGTTCATGTTCTTTTGTAA AATTTGAGTTTGAACTTGAGTTTTAACTTGAGTTTGGGGCTAAAATCTGAGTTCAAGTTTCCCCTTCAACTCAAGTTCTT AAACTCAAACTCAAGTTAATGAACAATATTTTTTCTATTCTTAAAAACGTCATAACTTTTTCGTTTTAATTCCGATTGAG ATGATTTTTTTTCTATGCGTTCACAACGAAGAGACGAATAAAACCCCACCCATATACCCTATTAAAATTTTTCATCACCA TTGAGTTTTTATTAAAATACTATCTAAATACAAATTCAAGTTTTGACCCACTCAAACACAAACTCAAATAGATTCTCAAT TCAAATCATAACTCAAATGTGCACATCCAAACACAAACTCAAGTTACAACTTCAACTCAAATTATAACTCAAATTCAACT CAAGATCTACACTCAAGTCACCATAACTCAAAAATGCAACCGAACAAGCCCTTAAT >DTH_1N_20_Mno length=164;Class=DNA transposons;Order=MITE;superfamily=MITE; GGCCTCGTTCACTTCGCGGATTTGAGTTTTCAATTCGAGTTGAGATGTGATATTTTTTAAGAGTTTTTAACTGTAACAGA AAAAGTTAGATGTGACATTTTCTGAGAGTTTTTTACTGTAAAAACCTAAAACTGAAAACTCAAATCGGTAAAATGAACGA GACC >DTH_1N_21_Mno length=158;Class=DNA transposons;Order=MITE;superfamily=MITE; TGAACAATTTAATACAAATTATTAAGGCCCCGTTCATTTCGCCGATTCGAGTTTAGAATTCGAGTTTTGCTACAGTAAAA AGCTCTCAGAAACAGTCACATCTAACTTTTTTACTACAGTAAAAAGCTCTCACACAAAATCACATCTCAACTCGAATT >DTH_1N_22_Mno length=152;Class=DNA transposons;Order=MITE;superfamily=MITE; AGGCCCCGTTCATTTCACCGATTCGAGTTTAGAATTTGAGTTTTGTTACAGTAAAAAGCTCTCAGAAACAATCACATCTA ACTTTTTTACTACAGTAAAAAGCTCTCACATAAAGTCACATCTCAACTCGAATCAGCGAACTAAACGGGCCC >DTH_1N_23_Mno length=127;Class=DNA transposons;Order=MITE;superfamily=MITE; ATTCGAGTTTTCAGTTTTAAGTTTCTACAGTAAAAAGCTCTCAGAAAATGTCACATCTAACTTTTTCTGCTACAGTGAAA AGCTCTCAGAAAATGTCACATCTCAGCTCGAATTGAAAACTCGAATC >DTH_1N_24_Mno length=136;Class=DNA transposons;Order=MITE;superfamily=MITE; TTCGCTGATTCGAGTTTTTAATTCGAGTTGAGATGTGATTTTATGTGAGAGTTTTTTACTGTAGTAAAAAAGTTAAATGT GACTGTTTTTAAGAGCTTTTTACTGTAACAAAACTCGAATCGGTAAAATGAACGGG >DTH_1N_25_Mno length=111;Class=DNA transposons;Order=MITE;superfamily=MITE; GATTCGAGTTTTGTTACAGTAAAAAGCTCTCAGAAACAGTCACATCTAACTTTTTTGCTACAGTAAAAAGCTCTCACATA AAGTCACATCTCAACTCGAATTAAAAACTCG >DTH_1N_26_Mno length=116;Class=DNA transposons;Order=MITE;superfamily=MITE; TGATTCGAGTTTAGAATTTGAATTTTGTTACAGTAAAAAGCTCTCATAAACAATCACATCTAATTTTTTTACTACAGTAA AAAATTCTCACATAAAATCACATCTCAACTCGAATT >DTH_1N_27_Mno length=131;Class=DNA transposons;Order=MITE;superfamily=MITE; CCGTTCACTTCGCTGATTCGAGTTGAGATGTGATTTTATGTGAGAGCTTTTTACTGTAGCAAAAAAGTTAGATGTGATTG TTTGTGAGAGCTTTTTACTGTAGAAAAACTCGAATCAGCGAAGTGAACGGG >DTH_1N_28_Mno length=120;Class=DNA transposons;Order=MITE;superfamily=MITE; GGCCTCGTTCAGTTCGCTGATTCGAGTTTTTAATTCGAGTTGAGATGTGATTTTATGTGAGAGCTTTTAACTGTAGCAAA ACTCGAATTGAAAACTCGAATCGGTGAAATGAACGAGGCC >DTH_1N_29_Mno length=154;Class=DNA transposons;Order=MITE;superfamily=MITE; TTTTACAAATTTAAATTTTTAATTTAAATTGAGATATAATATTTTTTAAAAATTTTTTATTGTAATAAAAAAAATTAAAT GTGATATTTTTTAAGAATTTTTTACTGTAAAAATTTAAAATTAAAAACTCAAATCAATAAAATAAACGAGACCT >DTH_1N_3_Mno length=1048;Class=DNA transposons;Order=MITE;superfamily=MITE; TGTTCTTTTGTATTAAAATTTAAAAAAAATTTGAACTCAAGTTATAATTTTATTCAAGTTCATGTTCTTTTATAAAATTT GAGTTTGAACTTGAGTTTTAACTTGAATTTTAACTTGAGTTTGGGCTAAAATATGGAGGGTTTGTTCTTTTAGAGTTTGA CTTGAGTGTAGTTTTTGAGTTGAATTTGAGTTATAACTTGAGTTGAAGTTGTAACTTGAGTTTGTGTTTGGTTGTGTACA TTTGAGTTATGGTTTGAGATAAGAATCTTTTTGAGTTTGTGTTTGAGTGAGTCAAAACTTAAATTTGTATTTAGATAGTA TTTTAATAAAAACTCAATGGTGATGAAAAATTTTAATAGGGTATATGGGTGAGGTTTTATTCGTCTTTTCGTTGTCAACG CATAGAAAAAAAATCATCTCAATCAGAATTAAAACGAAAAAGTTATAGCATTTTTAAGAATAGAAAAAATACTGTTCATT AATTTGAGTTCGAGTTTCTGAACTCGAGTTGAAGGGGAAACTTGAACTCGAGTTTTAGTCCCAAACTCGAGTTCAAACTC GAGTTTAAACTTAAAAGAACATGAACTTGAATAAAGTTGTAACTCGAGTTATCTTTTTTTGAGTTTTTAAGTCAAAAGAA CAAGCCCTAAGTTTCCCCTTCAACTCAAGTTCTTAAACTCAAACTCAAGTTAATGAACAATATTTTTTCTATTCTTAAAA ACGTCATAACTTTTTCGTTTTAATTCTGATTGAGATGATTTTTTTTCTATGCGTTCACAACGAAAAGACGAATAAAACCC CACCCATATACCCTATTAAAATTTTTCATCACCATTGAGTTTTTATTAAAATACTATCTAAATACAAATTCAAGTTTTGA CCCACCCAAACACAAACTCAAATAGATTCTCAATTCAAATCATAACTCAAATGTACACATCCAAACACAAACTCAAGTTA CAACTTTAACTCAAATTATAACTCAAATTCAACTCAAGATCTACACTCAAATCACCATAACTCAAAAATACAACCGAACA AGCCCTAA >DTH_1N_30_Mno length=83;Class=DNA transposons;Order=MITE;superfamily=MITE; ATTCGAGTTTTCAATTCGAGTTGAGATGTGACATTTTCTGAGAGCTTTTTACTGTAGAAACCTAAAACTGAAAACTCGAA TCG >DTH_1N_31_Mno length=579;Class=DNA transposons;Order=MITE;superfamily=MITE; AAGCCCCTGTTTGTTTCAACAACTCAAACTGTTGTTTAGGATTCAAACCTTAGTTCAGGATTCAAATTGGTGTTTGGGAG AGGAAAATTCAAGGACAATTCAAACCATTAACAATGGTTCAAGGACAACTCAAATTGTTGATTTTAGAATTCACCTCCCC CCTAAATTCTAACAATCCGAATTGTTGTCAACAGTCTAATAGTTTCAGATTCTACTTTTTCTCTCTCTTCAATTTCAATC TTAAAAATGTCATAACTTCTTCGTTTTAATTCCGATTGAGATGATTTTTTTTAATGTGTTCATAATGAAGAGAGGAACAA ATCCCCACCCATATTGCATATTTTTTAATGTCATTTATAATGAGGTTTTATAAGATTTGTTACAAAACTCTAATGACAGT TTTCAACACTTTATCCAAACACAGTTCGGATTTTATTCCCAATTCAAATTACAATTTATTTGCATATCCAAACAACAGTT CGGATCACAGTTTGAATCACCACAGTTCAGATTCTACAGTTCTAACAAAAAAGGTTCAAATCTCCACAGTTTGAGTTGTT GAACCAAACAAGCCCTAAA >DTH_1N_4_Mno length=671;Class=DNA transposons;Order=MITE;superfamily=MITE; TAAGGGCTTGTTCTTTTGAGTGAAAAACTAAAAAAAATACAACTCGAGTTACAACTTTATTTGAGTTCATGTTCTTTTAA GTTTAAACTCGAGTTTAAACTCGAGTTTGGACTAAAACTCGAGTTTAAGGCCTCGTTCAGTTCGCTGATTCGAGTTTTTA ATTCGAGTTGAGATGTGATTTTATGTGAGAGCTTTTTACTGTAGCAAAAAAGTTAGATGTGATTGTTTCTGAGAGCTTTT TACTGTAGCAAAACTCGAATTCTAAACTCGAATCGGTGAAATGAACGGGGTCCCCTTCAACTCGAGTTCAGAAACTCGAA CTCAAATTAATGAACAATATTTTTTCTATTCTTAAAAATGCTATAACTTTTTCGTTTTAATTCTGATTGAGATGATTTTT TTTCTATGCGTTGACAACGAAAAGACGAATAAAACCCGACCCATATACCCTATTAAAATTTTTCATCAGCATTGAGTTTT TATTAAAATACTATCTAAATACAAATTCAAGTTTTGACTCACTCAAACACAAACTCAAAAAGATTCTTATCTCAAATCAT AACTCAAATGTACACAACCAAACACAAACTCAAGTTACAACTTCAACTCAAGTTATAACTCAAATTCAACTCAAAAATTA TACTCAAGTTAAACTCCAAAAGAACAAGCCC >DTH_1N_5_Mno length=338;Class=DNA transposons;Order=MITE;superfamily=MITE; TATTAAGGCCTCGTTCACTTCGCGGATTTGAGTTTTCAATTCGAGTTGAGATGTGATATTTTTTGAGAGTTTTTTACTGT AGCAAAAAAAGTTAGATGTGACATTTTCTGAGAGCTTTTTACTGTAGAAACCTAAAACTGAAAACTCGAATCGGTGAAAT GAACGAGGCCTAAGGCCTCGTTCATTTCACCGATTCGAGTTTTCAATTTTAGGTTTCTACAGTAAAAAGCTCTCAGAAAA TGTCACATCTAACTTTTTTTGCTACAGTAAAAAGCTCTCAAAAAATATCACATCTCAACTCGAATTAAAAACTCAAATCC GCGAAGTGAACGAGGCCT >DTH_1N_6_Mno length=186;Class=DNA transposons;Order=MITE;superfamily=MITE; AATAAAAATTAAGGCCCCGTTCATTTCGCTGATTCGAGTTTAGAATTCGAGTTTTGCTACAGTAAAAAGCTCTCACAAAC AATCACATCTAACTTTTTTGCTACAGTAAAAAGCTCTCACATAAAATCACATCTCAACTCGAATTAAAAACTCGAATCAG CGAACTAAACGGGCCCTAAATTTTTA >DTH_1N_7_Mno length=206;Class=DNA transposons;Order=MITE;superfamily=MITE; AAAAATTAAGGCCTCGTTCGTTTCGCTGATTCGAGTTTAGAATTCGAGTTTTGCTACAGTAAAAAGCTCTCACAAACAGT CACATCTAACTTTTTTGCTACAGTAAAAAGCTCTCACATAAAATCACATCTCAACTCGAATTCTAAACTCGAATCAGCGA AACGAACGAGGCCTTTGATTTTAAAATTAAATAAAAAATAATATAT >DTH_1N_8_Mno length=340;Class=DNA transposons;Order=MITE;superfamily=MITE; GCTGATTCGAGTTTAGAATTTGAGTTTTGCTACAGTAAAAAGCTCTCACAAACAGTCACATCTAACTTTTTTACTACAGT AAAAAGCTCTCACATAAAATCACATCTCAACTCGAATTAAAAACTCGAATCAGCGAACTGAACGGGCCCTTTAAAATAAT TTTTAATTATAACTTCGAATAAAATTTTTAGGGCCCGTTCAGTTCGCTGATTCGAGTTTTTAATTTGAGTTGAGATGTGA TTTTATGTGAGAGCTTTTTACTGTAGTAAAAAAGTTAGATGTGACTGTTTGTGAGAGCTTTTTACTGTAACAAAACTCAA ATTCTAAACTCGAATCAGTG >DTH_1N_9_Mno length=174;Class=DNA transposons;Order=MITE;superfamily=MITE; ATTTTTTTTATAAAAAAAAATAGGCCCCGTTCACTTCACCGATTCGAGTTTAGAATTTGAGTTTTGCTACAGTAAAAAGT TCTCAGAAACAGTCACATCTAACTTTTTTGCTACAGTAAAAAGCTCTCACATAAAATCACATCTCAACTCGAATTACAAA CTCGAATCAGCGAA