>DTC_9_1_Mno length=2894;Class=DNA transposons;Order=TIR;superfamily=CMC; CACTAGATCTGGGTTCTGGGTCCTAAAACAAGTCCAAAGAACCCAAGATCTCCAATTTCTACTCCAGTTTTACTGAAAAA CCATCGAAATCCGGTTTGAACCAAAAATAAGTTTTGAAATTCAAAAACTTGAGATTCAAGATAGGTTCTTTCAGTAATCT TACCTCGAATCCTTCTCTTGACGTTGAAAACTTCTTTAAATCTTTTCTTGGTTCAAGATCCGTTTGATTTAGGACATAAA TGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGNNNNCAGGAGAGTGAGAGTGAAGGAAAGAGAG AGAGTGCACGGGAAAGGAAAGAGAAAGGAAATGAAAAAGGAAAAAGGAAAAGAAAAGAAAAGGAAAAGGAAAAGAAAATG ACATGTGTCAATATTTTTAAAGAGCAGTCCAGAAATGCGCCCATACACACTTCTGGTTTAAAATAAATTATTAAGACTAA TTTAAATACCTTGGAACTATTTAAACTCACACGTGTCAGAAACATTTATTAATTAAACTCAATTAATAATCCAGATTAGG CACACTAATAATCTCAATTACCTTAATTAATCTCAATTAATTCTTCAGGGTGTTACACTATGTCAATGTGGAAAATGATG ATGATGAAGGTCTTATGGATGCATCGATTGAAATTGCAATAGGATCAACAAATCCTGAATAGTTTGATCAACTGTTTGAT GATTTGAAAAAACCTTTATATCCTGGCTGTGAAAAGTTTTCGGCGTTAACATTCTTGGTCAAATTGATGCATGTGAAGGT CATGAACAAATGGTGTAACAAAATGTTTGACATGTTGCTCAAATTGTTGATTGAGGCATTTCCAGAGGCAAAGTTACCGA GTTCACATTACGAGGCAAAATCATATTTATGCCCTCTTGGCTTGGGGTATGAGCCTATTCACGCTTATAAATATGATTGT GTCTTATTTTGGAAGGAGAATGCAGAGTTAGAAGAGTGTCCGGTGTGTAAGACGAGTTGTTGGGTTGATAAAGACACCAA GGGGGAAAAAATCCTCATAAGGTATTGCGTTACTTTAGGTTGGAGCCTCGTCTAAAATGATTATATCAATCAAGCCATAC TGAAAAAGATATGAATTGGCATGAAGTTGGTCGAAGCAAAACTGATGGGGTTTTAAGACACCCAGCTGATGGAGAGGCAT GGAAAAACTTTGACAAGATGTATCCTGACTTTGCGAAGGAGGCAAGAAATGTGAGGTTAGCATTGGCTTCTGACGGGTTT AATCCGTTTGGAAACATGAGCAATGCATATAGCATGTGGCCTATGATTGTGGTTCTGTATAACATGCCGTTGTGGAAATG TATGAAGGAGTCCGCATTCATCATGACATTGTTGATTCCATATAGATACTTATCTACGCCCATTGGTAGATGGGCTTAAG GAGTTGTGGGAAAAAGGGGATTGAACATATGACAAAGAAGAAGATGCCTATTTCTAGATGCATGTTGCATTATTGTGGAC GATTAATGACTTCCCTGCTTATGAAAATTTGTCTGGTTAGAGTACAAAAGGATATATGGCATGTCCTGCATGTAATGAAG ATACTTGTTCATGTCGTCTTACAAGTAAACCAGGTTACACGGGTCATCGATGTTATCTTGATAGCGAGCATCCATTTCGT CGAGACAAACAATTTAATGGCTTTGTGGAAATAAGGACGGCTCCAAGGGTGAGAAATGGTAAGGAAATCTTGAAACAACT TGAACATATTAATGTTGTTCCTGGAAAGCATCCTAATTTTGGCGGAAAGAAACATAATCATGACAAGAATCAACTTAACT GGACGAAAAAAGTATATTCTTTGAACTTTCATATTGGTCAAAGCTTGACTTGAGGCACAATCTTGATGTTATGGATATTG AGAAGAATATTTGTGATAGTGTAGTTGGTACTTTACTTAGAATTGAAGGGAAGTCAAAAAAGACAGATAAAGCTAGAATA AACCTTGCAAACTTGAAGATAAGGAGAAAGTTGCATTTGAAAAAGTCAGGAGACAAGTGGATTAAACCCCATGCGGCGTA CACATTGACTAAAGATGAGCGCCGAAAATTTTGTGAATTCCTTAAGTCTGTCAAATTTCCAGATGGTTTCGCAGCGAATA TTGGAATAACTGTTAATATAGTTGATGGCAAAATTTCTGGTTTGAAGTCGCATGATTGTCATGTGCTTTTGCAATAGTTA TTAAAAGTTGGAATTAGCCCATTTCTAACACGACAAATACAAGATACACTTTCCGAGTTAAATAATTTCTTTAAACAATT ATGCTCGAGGACTTTACATGTCAAAGACTTAGAAGATTTAGAAAAAAAGATTGCTATTATTCTCTCAAAACTTGAAAGAA TATATCCTCTAGCCTTTTTTGATATTATGGTTCATTTAGCTATACACTTACCTTGAGAATCTATTCTTGGTGGTCCAGTT CACGCTACATGGATGTATCTTTTTGAACGATATATGAGAAATATGTTCGAAATAAAGCTCACCCAAAAGGATCAATTGTA GAGGTGTATATAGTGAATAAAGCTTTGACTTTATGTTCAATGTATTTTCATGGGATAGAAACAAGATTCAATCGGCCTGA ACGAAATTATGATTGACCAAACAACACTTCTCAAACACAGTTGTTAGTTTTTTGACATCTAGGCCGTCCTATAGGAAATA AGGACTTAATCAGACTTGATAAGAAGTTTTGGAATGATGCACATTGGTTCATTTTGAATAACTGTCCATCGATTAGAAAA TATCTTAAGTAAGTGCATTTGTCTACATTATGTGCTTTTTATAGCTATAAATTGTGCTTAAACTAATGTATATTTACAAT AAATTTGTGTAGTG