>DTC_8_1_Mno length=14277;Class=DNA transposons;Order=TIR;superfamily=CMC; CACTATGGATTTTCTAATGGGGCTACCGAGAACGAGCTGAAGCACAATGCCATCTGGGTGGTGGTGGATAGGTTTACGAA GTCCGCGCACTTCATACCGTTCTGTGCGACGTATTCTCGGAAGATTCTGTCAGAATTATACCTGGAGCACATCGTGAGAC TACACGGAGTGCCACTGTCTATCACGTCTGATCGTGATACACGCTTTAATGCAAGGTATTGGAGGAGTTTCTATAAAGCC ATGGGAACAGACTTGAACTTTAGCACCGCATTTCATCCTTAGACTGATGGGCAATCTAAAAGAGTAATTCAGATTCTAGA GGATATGCTTCGTGCTTGTATTATGGAATTTGGTGGAAACTGGAAGAAATACCTACATCTTGCTGAGTTTGCATACAACA ATAGCTATTAGACCAGTATTGGCATGGCACCGTTTGAGGCTCTCTATGGTCGTCCTTGTAGGTCACCTGTTTGTTGGTTG GAACCAGAGGATCGACTGAGTATGGGCCGGAGGTCATTTAAGAGAACAATGAGAAGATAGATGTGATTCGGGAATGACTG TTGACAGCTCAAAGTCGTCAGAAAAGTTCTGTTGACAGAAGGCGTAGGCCTTTAGAATTCCAAGAAGGCGACTTTGTTTT GCTGAGGGTTTCCCCACGCAAGGGAGTTGTTAGGTTTGGTGTGAAAGGGAAACTTGCACCAAGGTATGTGGGACCATTCC CGATCGTGCAACGAATCGGGTGGTGGCTTATCGGTTGGCTTTACCGCCTGAATCACGTGCATGACGTGTTTCATGTCTCC ATGCTTCGAAAATGTCAACCTGAGCCGGAAGCTGTAGTGCAGTGGTTTGACGTTCTGATACAGTATGACGCGTCATACGA GGAGGCACCAGTTCAGATTCTTGACTGAAAGATAAAGAATCTACGCCATCGTGAGATCCCGTTAGTGAAAGTGTTGTGGC AGCACCATGGAGTTGAGGAAGCGACATGGGAACTTGAAACGACGATGCAGGAGTAGTATCCGCATTTGTTTACACTTTGG GGTAGGGCTTAATTTCGGGGACGAAATTGCCTAAAAGGGGTGGAGCTGTAACACCCTGAAGAATTAAATGAGATTAATTA AGGTAATTAAGATTATTAGTGTGCCTAATCTAGATTTATTAATTGAGTATTAATGAATAAATGTTTCTGACACGTGTGAG TTTAAATAATTCCAAGGTATTTAAACTATTCTCAGTAATTTATTTTAACCCAGAAATGTGTATGGGCGCATCTCTGGACT GTTGTTTTAAAATATTGTACACATGTCCTTTTCTTTTTCTTTTTCCTTTTCTTTTCTTTTTCCTTTTCTCTTTTTCTTCC TTTTCTCTTTCTCTTCCCGTGCTCTCACTCTCTCTCTCTCTCCCTCTCTCTCATTTTTGTCCCAAATCAAACGGATCTTG AACCAAAGGGGAGTTTCAAAGCGTTTTCAACGTCAAGAGAAGGATTCGAGGTAAGATTACTGAAAGAACATCTATTGAAT CTCAAGTTTTTGAATTTCAAAATTTATTTTTGGTTCAAACCGGATATTGATAGTTTTTGAGTAAAACTATGGTAGAAATT AGAGATCTTTGGTTCTTTGGACTTGTTTTAGGACCTAGAACCCGGATCTAGCGGTTTTCCTTTGAAATATTTCGATTTGG GACTGAGATTGTAGGTTTTTGGACTGGTTTTCGTGAGCTTCTCTAGTACAGCTGATTCCACCAGTCGACCGGATTGCATT GGCCTGACCGGTCGACCGGAGTGTACACCACCGGTCGATTGGTGGTAATGCATTGTTCTGTCACCGGTCGACCAGTTGAC ACGGGGTTTGACCCTGTTTGGCCTGAAATTGCTGTTTTGACCACTGTTTTCAGGGAGAACCCAAATTAGCTTCATTTGGG GACTTGAGATGAATGAATTAGCATCCTTAATCATTGTTTTGAGATCGAAAACCCTTGGAATGATAATTTGAAACATGAAA ATGGATTAGGGCACACTAATAGGAAATCTTAGTTGGAAATTGAGATTGGATTGCTTTAGGAATGAGAATTAATCCTAAAG TGTTGTTTTGCATCAGTGATCACTGAGGATTCAGACTGAAGGGGCTTGAGGAAGCGGAAGCCGAAAAAGGCAACGCTAGT CCCAAGTTTGATAGTGCGAGGTAGGATTTCTATCCCCTTTTCCTTATGAGCCTGTTTTCAAAAAGGATTTCGGCCTTGAA AATGTTTTAAAAGAAAATTGTTGGTTTACGAAAGAAAAACCCTTTGAAAACCATGGCTTGTGGGGTTTATGGAATCCATG GCTTGTCCTGTCCATGGAATCTATAGCTTACCCAGTCATGGAACCTCATGGCTTGCCCAATCATGGGGCCCGCAGCTTAA GTAGTTCGTGGGGTCATAATAACGATTTCAGAAAGTTAATGAATGATTTCTTAAGCAAAGAGATCTTGTGAACTGGTAAG AGAGTCTATTGCTGTAAGCCTAGATAGGATGCGGATAGTGCATCCTCGGAGGCAGAACCCGAAACTCGGTCCGGGTAGGC GAGGCACTTGGTTAGGTAAGTAATTTGTACTAATTACTTGCTGAAGCCTGTAATATGGTTATTTTCAGTTATATTTCCTT TGAGAAAAAGGATGTGAGGTTCCGGCTGTCTGTTGGAACTGAATGTCTATTTAATTCATTTACCCATTTATTTATTTACT CGCACAGTTATAAGTTCATTTATTTTTAAGTCACTTCAAATTATATCCTATTGGGCCTTTCGCTCACGTTTTATGTTTTA AATGTATTAAACCCCTCCCAAGAGATTCTCAGAGCGGTGCGTAGTAGCTGGATATTTGCTACGGAGTAGCTGAGTTGTGC TACGGATCGATCATGTGAGGATTGTGTTCATCCTCTGGAATAAAATGTAAGGAATTGAGAATTCTGTAAACTCTAGAAAT ATGTTGATTAATTAGACTGTGGTTGATGTCTGTTGTAATTGATTATTTACATGTGTATGTATGTACGATACTGTATGTCC TGTGGGTGGAGCCCTGTGTGTTGTCAGAGGCTCGGGATTCTGTAATTCATTTATATTTTAATTCAGTCGAGTGAGGCTCA TCTGGGAATCTGCTTTATTAATCCATAATCGAGCTCCACATCACCCATCCCGTTTGGGGGGCGTGACAAGACCCGTTCGG GAGTCTGGTTGATTGTCTCACCAAATCTTAAATTGTCTCGTCTGGACAGTTTGGGATTGTTGTCGAACATGTTCTTTATT CTTGTCCACATCATGTTTCATGTTGTAGAGATTTCGTGCGATCTCCCTTATTTGTTCTCCGGGTAAGTAAAATGTAGCAC ACTTAGGAGAACTAAAGGAAGATGCTGCCGAAATTTCTATGTGAATGGAGTGTTGTGGACATGATAAGAGACATGTACGT TGCCATCCTGAATGAGATAGGGCCTTACCTTACAGATTGGGAGTTAAAGGTGGTTAATAGGTTACATGCACGAATACATA CATATAATTACCTTTTTTATCATACTTTATGTTTTCGTGATTTTGATCCAAAATGCCAATCGATAAGAGTTGGATAACAG TAAAAGATCGTTTCTCAGAGCAATATTGGAATGGTGCAATGGCGTTCATGGAACGGGCTAAGAAATGTTTAAATGAGGAA GGACTATTTAGTTGTCCATGCATAAGTTGTCTAAATTTGTTGATGCATTATCAGTAGTTGAAGCTCATATAACAGACAAG GGATTTAATGCATCGTACGCGAAATGGACGTATCATGGAGAAAAAACATATGACACTGACATAACTGATAATGAAGCGCT TGAATCATCTGATGAGCTACGTGACATCTTAAAATGATATAGCTGGGACTGGCTGTAACCATGGTGACCCGGATGGTGTA AGCGCAAGTGAAGAATATGAAGAATATGAGCCTTCCCAGTTCCAAGAGCCTTTTAATGAGCTTGAATCAGAGTTGTATCC GGGTTGCACTAGCTTGTGATCACTTAATTTCATAGTCAAATTCATGCATTTGAAGGTGCTTCACAAATGGACGATTGCGT CATCACACTATGAAGCAAAGATGAAGTTACGCAAGTTAGGTTTGGGTTATGAATCTATTCATGTATACAAATACGATTGT ACTTTATTTTAGAAAGAGTAAGCGATCTAGAAAATTGTTCTGTATGTGACAAAAGTCGTTGGGTGAATAAAAATACAAAG GGGAAGAAAGTGCCTCATAAAGTATTAATGTACTTTCCCTTGAAAGGCCGTTTAAAGCGATTGTACGGATCAAGACATAA TGCAAAGATGATGAGATGGCACGAACATGGTTAAGCTAAGGAGGAAGGAATCTTGTGACATCCAGTTCATGGTGAGGCTT GGAAGAAATTTGATCGTAGGTGTCCAGACTTTGCTTCTGAAAAAAGAAATGTTCGTCTCGGCTTAGCGGCAGATGGCTTC AACCCATATGGGAACAAGAGTCTGTCATATAGTATGTGGCCAGTTGTCATGACAACATACAACATACCGCCCTGGTTGTG CATGAAAGAGCCGTACTTTATGCTCACCCTCCTGATACCGGGTCCGAATGCTCCAGCGAAGGATATGAATGTGTTTTTAA GGCCTCTTGTTGATGAGCTTAAAGAGTTATAGGAAACTAGAATTTTTGTTCGTGATACTGTTGATGATAAATCCTTCAAG ATGCGTGTTGCGTTATTATGGACTGTAAATAATTTTCTTACTCATAGTAGTTTATCAGGTTGGAATGGTCAAGGTTATAA AGCGTGTCCAACATGCAACATCCATACTCCTTCAAAGCGGATAAAAAATAATTTGGCCCCATTCATTTTACCGATTCGAG TTTTGCTACAATAAAAAGCTATTAAAAACAGTCACATCTAACTTTTTACTACAGTAAATAGTTCTCACATAAAGTCACAT CTTAACTCGAATTAAAAACTCGAATTAACGAACTAAACTAGTCCAAAAAGTTATTTGCACTGGCCATCGTCGATACCTAT CATCCACAAGTAGAATGAGAAAAGATTTACAATTTGACGGTACAATTGAGAATAGACCTTCGCATCCAAGGATAACTACT GCAGAAATATTGAATCAATTACGACAAGTGCATACATATTGAATCAATTACGACAAGTGCATAGCAGATTGCCCAGCAAA CATTAAAAGTTTGGTGGAGCGAAACGTAAGCGTGATCCAAATGAGTTGAACTGGACCAAAAAAAAGTATATTTTTTTAAT TAGAATATTGGTTAGATTTATTGATGAGGCACAATTTAGATGTAATTCATATTGAGAAGAATATATGTGATAGCTTGTTG AGAACCATTTTGATCATTGATGGAAAATCAAAGGATACCGACAAAGCCCGGATTGATTTAGCTGAGATGAAAAATAAAAA AAGAGTTGCATCTATATAAAGATGGGAATCGATGGATGAAGCCGTATGCAGACTACACATTGACCATAGCCGAGCGAAAA CAATTTGCCTCGGTTATATTAAACTAGAAGTACAAATATTACTTCTAGTTTAATATAAATATTTTTCCACATGTGTTAAT TAGTAAGTAAGGATGTAGGAAAAATTATTGTCACAATAGGTTTTATAGATATGGTTGGGCCAGTTGCTACTTGTGCCGGA TTTGCAGGGCGTTTTGAGCCTCCACTAGGGCTCCGGAGATTACCTACACACTCTGAGTCAGATATGAATAATTTTGATAT ATATGGTACTCCATTTACATTTATTATTATTTGTTATGTCTCTAATTATAGCAGAAATATAGCAGAAAAAAGTTCCGGCT GAATTTAAGGTTGACATTTTACCTGAGACTAGAACATGCCAACTAACGTTTGTATTACATTGGTCTAAATTAAAGAATTA AATTATGTCTCACTAGTTTCGTTTGGGGTATACTAGTGGTTTTTTTCGGAAATAGTAGAAAATAGGTCAATATGAAAAGC TTAAGAAAGTATATAGGTCAATTTTTAGTTATAGAAATTAATAGGCCATAACTTATCAAGTTATGGTTCATAACTAGATA AGTTATGGATAAACTTGTCAAGTTATAGTTCATAGCCAGACAAGTTATGGACAATTATGGACAATAACTTGTCAAGTTAT GGTTTATAGCCAGACTAGTTATGGACGAAAACAGTAATTTAGCATATTTATTAACTTATGTAAACTATTAGCCTATTAAT TTTAATTCATCTCAAGTCTTGGTCTATTATCCTCTTTCTCCCGTTTCTTTTTTCTGCTTCTTTGAGATGATCTTTCAGAG TTTTTTCTAGTTGGGCTTTGATGTTGGGTTTTACTTTGACACTTCAAGAAAATTACAGATTTCATTTTTTAAAATATCAA GTCTGCCCCTTATTAGTTTTAATTTAAAAAGTAAAATATATGGACTAATGTTAAAAGATAGAAATGAACGGGGCTCTATT TTAAAGGGTATTTTTAAAAATTACCCTTTTACTTTTTTTTTTTTTTAACAATGGTTTTTTCCATTGGATTTTACTCTTAA GGTTTTTAACAAATCTATCATAAAAACTGGTGTTTTCAAAAATATGTTTTGAATATTTATTTTAGCGTCATGTGTATTCA TGTCTGTGCTCCACTGTTTTTCCTATCATTGGAAGTTAGGTTTCTGGAATAGTTTCATTTTGGATTATTGCCCGATGGGG TTTTATTTCTCTACTTTTCTAAACATTTGCATTTTATATATTTTTTCTCGTGTTTATTGATAAATTAATTTGGGGCTTGG TTTACTATGAAATTTCTAGTCGGTGCCAATATAATTGCAGTGTGTTAGGGTGCATTTAGTTGCAGTAACAGAATGATAAT GAGAATGATATTGGAATGAAATCCGAATGTGCTGAAAACATAAACTGATTTTTTTAGTTTAGTTATAGTTGTGAAATCAA TGAAGATTATGCTGTTCAGACCACAGAATGGAATGAAAGAAAACTATATTTTAACAAAAATATCCTTGACTAATAATCAT TAGGTCATTCGATATTTAATTAATTAAAATAGTAAAAAAATAATTTAATTATTAAAAAACTATTTATTTGAAGGATAAAA TTAATATATATATATATATATATTTCAATGATAGAAAAAATAATATTTGATTTTTTATTTAAAACTGTAACACTTGAAAT TAACTTAAATAATCTTGTGCATTATATTTAATTAATTCTAACATTACATTTAGTTATTTTCTATAAGTGAAGTTGATGAG AACTCAACGTGCTATGAATAAGTTCATGTCATTTTATAAAAATTATATGTAATTACGTGTTTTGCGTAATTTGATAAGGC TACAGATTAAAATCAGATTGTTTTATGTGCACAAACACACATGCATGCATGTGTGCTGGCGTACACACTAATTAAGATTA ATTAGCTTTTTTAATCAAATTATCTATAAATAAAAACTTCTGAAGAAATTATAAATAAGAGTAATAAGAATCATAATATG ACAAACAATAAGCTGGTAGTTATCTATCCTCTTTTAGCTACACAAAAGGTAGTACAAAAATATAATTTTCTTTCAATATT GGATACCGACAAACATATATAGTTGCTTTCCTTGGCTTGAGTCTAGCTACAAACACATAAATTTCCTTCTATAACTTTGC TAATTTCTTTTGACATGAATGAAATTGTTTCTCAAAAAAGATACTTTTAGTTTTCTAACAATATTTTAATTAACTAAAAT TCGTCAAGTTGACATTCATACATATTAGTGACTCGTTTGTCTAGGATACTTCATTATCAACTTCTGGACCCCCCTAATGT TTGGCCATTGATTGACAAAGTATAATGGCATTGTTCTCCGCCCTAGAATATATATATATGGCTTGTGATCCAAATTGGGA CAGAGCAATTTTTTGCCTACCACTAAAGATCACTTGGATGACAATATTAGGGTAGTTGGATGTTTGGTGGATTATTATTA TTTTTATTATTTTATTTTTTGTTCTTGTACTTTTTCAACTTCCCCTCACGTTTTCTTGTTTTGCCCTATTAATATACTTC CAAAATAGGGTAAGATACAAAAAACTATCCTTTCATGGTAAAAGCCCTCATGTGGTGTCCCTCAAAATCCCACAAAATCT TTGATTAAACGTCATGTAGACTAAATATAATAAAGAAGTTACTCTTTGGAAAGGCCAAGTGACTCTAGCAATATAATTTG TGTATTAAAGAAACAAATTCGAACTTTTGAGTTTTATCCCACTAAGTTACAAAGTTTAGCATTTTTTAAGTCCGAGTATT TTGATTTATAACAAGACAAGAAAATCATATGTTATTTGATAAATATAACACTTCTTAGTAAGGATTTGCTTATCAGAATA ATGAAATGATGATGAAGGGAAGAAAACTTGGGTATGGTGAATTAACTATAATTTGAGAACGAAGTTAATTTGTATCTATA TGTGTATTCATGCCAACACAATAATTACACAAAGGGCCTTAGTGAAGCACTACAGATTCTTAGTTTTATGATAATATTTC TTTCATTTCATTTCCTTTTTTTTTTTTTTTTTTGGGTTGAAAAAGATACGGATACGATTTATTATCAACGTCTATATATC TTCCACATCATTCAAAAGCTAACATGCATTACTGCCACCGCACTCCGCACATGCAAGTGCAAAGAGCTCTAAGCATTAAC TTCTTTTATAGGATGGATTTATTCATATGAAAAAAAAAAAAAAAAATTGTAAGGACATTTGTAGCATATATATATATATA TATATATATATTATGCCTTCCACGCATTACGGCAGCCACTACCCAACAATTATATATTTACAATCATCTCACCCTTCACC ATCACCATATTCTCTGTACACATTAATTAATGTTGTTAGGAAAAACCTAGGCTAAAACATAAATTAATTAACAAGACGAA AAATAATGAACGAAAATAAAAGTAGAAATCAATATTAATAATTTTATACAAGTTCACGCCTTTTCTTCGACGTAGCACCG AGGTGCCCACCACTCGGCGTTGCGGCGCTGCCTGTTCTGATTCTCATAAAATTTGGCTCCAAATGAGATTAGGCTCCATT CTCCTCCACATGTACACTACTCTACAATGAAACAAAAGGCTTCTCTAGTAATGAGTGTGCACTGATTAATTTCAAAACCT ATTAAATATTTAAAGTACATCATAAAATTTGTTTAACAGTTGGAAAATAGATTAAGGACACTAATCTATGACGAAGTTTT TTTTTTTTTTCCACCTATGCCTACATGTTATTATTACAGAATTTCCCCTAAGAAATATAAACTCTACTGACAAATGTTCA TAATTGACATTTAACCATTAATACACAGATTTTAGTTCATCTTAATGGATAGGAGTTCTTCTGAGTTTTTCAATTTTTTT TTTTTTTCAGTGGCATTTTGGAGCGGATTTTGGCATCCACCTGGATTTGTAATATTTAACATTTAATCTTATTTTTAATA AAATTGAATGAAAAAAATTTACGTCTCCGTTAACTGCGGAGCTCATCGCACAAGTGCTCTTTAACATTAGTTATTCTCTG TTTTCGTTTAAAAAAAAAAAAAAAAGCCAAATCTTCAACTTCGTATGAGGACCACTATTGGTGCTAGCTATAGCTATTAA CCTTTGCTTTGCTTCACGAGCACAAAGTTACAAATTCGTAGCGTTTTGTACACTATGTTTTTAATTCCTTAAGAGAATTT CTCTGGTAGAACCGGAAAAATGAATTATTAGTAGCTGTCAACTTTTTAGCCGTTAAATTTATATTAAAAATTGACTTTTT TAATATGATATAATTTTAATTAAATTTAATAGTCAGAAGCAAGGTAGTTGCTAATAGACTGGGCCTATCGAAAAAAGTCC TTTATTTTTATGAACTTTAGTTAGTGGTTTATCTATAGTACTGTTACTTTCTTCAAAAGCCGTACGATATAGAGATATAT ATACTTATCCAACACATATCTCACATAAACAAGGTCTGGAACGCACGCATTGGATCAAAATCTTTAAGGTTCTTTTTCCC CCTTTTTGTGTGGAATTTGGAAAATCCTCTCGTTTTTGCTTTAAAGTTATTTTGATCTAATCATACTTAAACAAAAAAAA AAATCTGCTCAAAGTACTCCTGCATAATATTAAATGTTTAATGGTTAAAAACAATATAACAGTACGTGGGTAATTAAACT AATTGTTCTCTGTATTTTCCACGTATATTTAGATGGATATTGATATTTTCTTTTTAAAATAAGAGAGAAATTATAGTAAC ATATATATACGTAAATTGTACTCATTGAATTGCGTTTTGTTGATCAGAAAAAGAAAGATAACATTCAACAAATTGGCATG AAGAAACTTTCGGTCCATTTTATTAATGACATGTCCCATTAAGATTCTCATCTCTCACGAAGCTTCAACTCTATTAATGA AATAAAGAAGAAAAAAAAAATTTAATAAAAGGAAAGAATAAATTAACTAGCACGGCGCAAGCTAGCAACATAAAATAAAT AGGTCGCAAAGACTTACAAATAGAAGCGACAAAAATTTGTTTTTACTTTTTGTTTTTTTTCATGAAGATCGATAAGCGAT AACTACCATATAAAAACATCCCACATAGGTTGGCACCTAAACCCTACACTATCTCACACTAAATCACTCATCCAAATTGT AAATAAGAAAAAAAAAAAAAACTCAAAACAACTAAACGTGCATGAAACTCTAATTGATATCTTCAATGGTAAAAAAGAAA TGTCGGCAGTTCAACGATGGACCACAAAATTGTGAACAAAACCAGGTGCCAAATTCCACCATATAACTTATAATTAGCTC TTGTTTGTATTATTACAACTTGTAACATTTCTACCTTTATCACGAAGTGTATATGTCGTTTTCTCTCTAGACTCACTAAA TCATAGCAGAAAACTTCTGCTAAATTAACTCCAAACCCCAAGGCAAACTGATTATCGCGTAACTCATCTATTAAGCATAA AAAGAAGTAATCGTCATCGTAAATCATGAATTCCATGCAACATACATGCACACATATGAACACAAGCTTTATTTAATATA AAAAAGATTTTACAAAACTAAAGTCAGGAAAATACCCAGAAAAAAATATAAGGAAAAAATTGAAAAAGAAAGCAAAAGCA AACAATAAAAATGAAATTACGAATAAAGCAACCAGGAAGCAACATAACCACAAAATAAAAAATAATAACATAAAGAACTT CACATTTTAAAACCCTTGCCACTACGAGTTGTACTGAGGAAGGGTTTTTTTTTTTTTACCTAGCTATAGCAACAAATTCC ATTTCATTATTGACACACACACACACACATATGTATATATATATATATATATATATACACCTAAAGTTCTATTTTCTTTA CCCTACAAATACCCTAGTCAATCTAAAAAAATATAGTAATATTAATAATAATAATAAATGAGTGAAATTATAAAGTAAAA AAAGCTTTTTGTAAATCAACTTTATTTTCTTGCATAGATGGTTCTCCAGTTAAATTGAGCAGATCAATTCGCTAGAATAG AGTGTATAGCTCTATAATTGGAGTGGTGGCGTAGAGATTACTTAAAATGCTTTCTGAGTTCTATAATTTCTCCAGGGACA GTGATAATTATATACATATGGTATAAAGACAGGTAATAATCTCACCAAATAATGGAAAAGCCTTTATGATCCCTTTCTTT TTACTTTATTTTCCTTGCAATATTAAGACACTAATATCTTTCTGTAACAAAGAATGGGTGATATAGCCAAAGATGAATAA CAATCACAAGAAAGTGTACTTGTTGCCTGCAATATACGGACTAAGCACATGCATAGATGTCCCTACAATCATTGCAATGG TGGTTATTTTCCATGTGGTTTTCTTTCTGACGTATCAAAGCAAGCAAGCTAGATAGCACCAAATCAATATCCTTTTGTAG CTACGTATACATAAGCTCATAGTCTAGCTAGCAAGAGATCGTCTCTCTCTCTCTACAAATATATATATATATATATATTA GTTCTTTTTCTGTGTCATTGATTGAATATTTCTGTCAAAGAGCAACTGTAATCAATAGCCTGTGTAGCAGTTATTCCTTT GCTTGTTTTTAGTGAAATTACTATATTTGTATAATTAGTAATTAATGTAGCTGGGGACCCTTATATTTCCAAGTCCTAGT ACTACTAAGAAGACAAAGAAAGCAAAGAGATTGGGATATTGGTGCCAAAACAATTAAGGTCTTGTGTTTTCTTTCTAAAG ATGTGTTGGAAAACAATCAATTGAAATTAGCTAAAAGTGAAAACCTTGACAAAGAGTAGGGACGAAAATAGGTAGTGGAG AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAAGAGAGGGAGAGAGCCAGAGAGAGAGAGAGAGAGAGAGA AGTAGTAAGTTGCTACGAGTATGAGCTGTTTGATTTGAAATAAGGAGAGGGAGAAAAGAGAGCTATAGCTTGAAAGGCAA AGGAAAAGAAAGAGTACCACAATATAGTCATGTGAAGGCATTTATAGTGGGGCTTTTGTGTTCTTTGTTTCCTAGTGCAC ATGGGAAGAGAGTCCTTTTAATAAGTTGGTGTGTAGAAAAGGCCATGGAGCATGTGAGGCCATGTGCATCTCCAAATTGA CTTCCTAAGATTTTTGCAAAAAAAAAATTTCACAATCCTTTTTCAAGAGGGACCAACGTTAGACATTAGGGTTTCGATGA TATTAATTTTGTTAGGGACAGAATTATGATGATTCAATCGAGCTTATAGATCTTTTTAGAAGAAAACACATGTAAAAAGA GAAATATGATTACATGTCAATGTGTTTGGTAATGAGAACGAGATCTATTGGTTATTAACTCCAACTTATGAGATAAGGTG TCGCTTAGTGACCTGTATATATATATATATGCCATGTCCACCATCTCTTTATTTAATAATAAATCCTTTAGGTCCTTCAT TCGGCACTGTTCAAACCTTGTTTTGCTTCTCCATTTCCTTGAGGTGGAGCCTAGTACTAACCGGCGACCAATATTCTCTC TCTGTTTCAACTGTGTTTGCATAACTTCTCTTGATGATATTTTAGTTTCAGATTTCTTGTTCTCATGATCTTCTAAATAG ATTTTGTCTTAGGTTTTGTGATAAAGAGAGGCAAGCTCACCAACAGCTTCTTTTTTCTCGTTCGATCGTCCGAGTTTTTT GTTTCCATTTCGTATTAGTGAAAGCGTTTTCCATCTTTCTTCTTTCTTCTTTTTTCTTTTTTTTTTATCCTTTGTGAATG GGGAGGCAAGTGATGAGCAAACGAATGCGCGTCTATTCGCAAGAAACAAACAAACTACTCCATCTTGCTTTTGCAAGAAA CTATATTAATCACTTGGTGCCAGCTCTTAAGAAGAAGAAGATGACGATCAATGACGAAGGAAGTGCTAGTTCTTCGAATG CTACTTCGCGGAATGGCAAAGATGGCAACGCCGAGCGAGAAAAGATCGTTCGATTCGAAGTCGACATGGCAATGGCGCTG TCTGCGAAAGAGTTTGCATGGAGCCGTGCCTTGGAAGCAAATCTTCGCAAAGAGCATGAAACTTTGCGTACAAATGGTGG GGTTACTCAAAAGCCTTCCTTTCATGATCAAACATCTTCTTTTATTCTTACTATCGAGTCCAGACCCATTTTTGAGGAAA GAAAAGGTGAGACTTTAACGTTATCGCCTCATAATCCTACATATGATAATGTAGTGAAAATTATGCCACTTGAAACCTCA CAAAACCCTAGAATATGCGACGTAAAGATCATGAAGAAATCTTCCGGCACTAAAAGTCGAAGATCGGGATCGATAAAAGG GCACGACAAGAAAAGTGAAGAGGACGTTATAAACGATAAGTTGGCGAATCTTAGAACGGTATTGCCTGGTGGAAATGAGA TGGGAGACCATGATGAATTGCTCACAGAACTAGCAAGTTACATTACCTGCCTCAAGTCACAGGTGCAAGTTCTTCAGTGT CTTGTAGAAAGTCAATGAATAAATTTTGTTTTAATATTTCTCTTTTAGCTTTATGAATGAAGTTATAATTTCCACTAGGA TAATCTAAGTTATTATAATTTGTATTTAATATGCTTTCTGTATATATATGTCTGCAGTATGCAGTTTAATTTACGTTAAT TCAGTTAGACTCGATGACAAACCAAATTATCATAGTG