>DTC_7_1_Mno length=5500;Class=DNA transposons;Order=TIR;superfamily=CMC; CACTATATATACATTCAAACTATTATACAGTCTATCATAGGCATAGGGACTCAACAATTGATGTCAGTCACCGATAACCT GGAGGACATGCATCGTCGTGGGGATACTTGGGTTAATTCCCAAGTTGAGAAGACTTTTGTAAGTATACTCATAATGTTTA ATTATATTTTTTTTATTTAAATCATATTATTTATTTAATTATTTTTCTTATAATATTTGTAGCATCAGATGGAGAGAGAA AGAGAAACGCAGATTCAGATGCAGTCTGCTACTTCCGGATCATCCGTTGTAGGAGCGGTTAATGAGGAGGATATTATGGA GCAGTTTCTAGGCACTCGCAGATGACACAAGACTGGAGTGGGTAGCACACTACTGCAAAGGGTTTATTGAGGGTATGCGT CATCATCTGGTTCACACTCGGCATGATCTTCTACGACACGTTCGGACCCACACGTAGAAGAATGCTTCCAACAGAGTTAC CAGCAAAACCTTCAGATGTATGAGAGCGTCAGAATGATGCGTGACATCATCACTCAAATGCGCCCTAAGATTTAGTTCCC ATCGGTTACTCCTCTTATGCCGTATGTCTGTTCAAGTCCTCCACCTCCGAATAATCCTTCCTATGATAACGACGATGATT CTAGTAACACTGCTAATTTAGGAGATTATATTTTTATTAATGTAACAATTTTTTATTTCTGTACATTTCTACTATAATTA CATTTTTATTTTATTTTATTAATTACTTTCTACTATAATAATTTTTATTTTTATTTTTTTATTATTTATTTCCTTTTATT TAATTCTTCTTTATTATTATAATATCATGAATTATATTTAATATTGGGTTTAATATATAGTAATATACAACATTAATTAT TAAAATGATAAAAAATAATTAATTAGTTAAAATATTATTTGTGACAACAAATGTGGTCACAAAAAATATAAGCCATATAA GCTAATTCTACATTTCTTGCGAAAACATAATTTGCAAATTACCGTCGCAAATACTTAATGCCATGTCATCTTAACGATGC AACCGATGAAATAATTACAGCGACACATTTGTGACTATTGTCGTCGTAAATGTAATTGCGACGACAGCTTGTTGTCGCAA AAATTTTTTTTGCGACGAATCAATTACAGAGACATGTTTACGACAAGTGGTCGCTAAAAATTTATTTGCGACCACTTTGT ATTTTTTGCAAAGACTTTTTGTCGTCGGTAATAACCCTATTTTTTGTAGTGTCAATAATAGTTGCTCGTATCCAAAATGA CCAAGATGTGGTAGGAAATGAAAAAAACAAAAAAAACAAAAAAAAAAAAACTTTTTTTGTAAATAAGTTCTATTGAATTT GCTAAAACTTATAAATGGAACAACCTCATGAGAGTGACTCGATTTATGTAGTTACTACTTTTACGGTTTCACATATTTTT AGAGAGAGTAATTACTACTTAATGATAACGTCCGGTGATTCTAAAATCCGAACTTCTACATGCCTCATACGAATGACAAT ATTTCAGGATTACCCAACTATATCCCTTCGTAAATAGCCGAATTATGCACTTTTTCCCTTCTAGTTTTGATTTTGACTAG AAAGGTTTTTAGCAAGGCATATTTGGAATAGCCAACAAGATTAGAGCCTATGGGACTAATTCCATTAATTTTAAAAAAAA GAAAAAAAAAACACACTATAAAGCTGTCAATTTGAACTTGACCAGACGAATCGGCATGACAGCTGTCTCTTTGACTCATG GTTTCTGATTGGGTTGTGTCTAGATCTTCGAAGTGCATAAAGACCTGGGTCAGGTCGGTTTGGACACGGTTAGGACTTTT TTATATTTTCTTATTAAAAATATGGGTCGCTCGGACTCTGCCCTACCCTAGGCATGCTGAACTTCCAGATTTTGTTGGCC TCTCATTCCCAGCATGCTCCTTTACTTAAGAAGTTTTTTTTTTTTTTTTTTTTTTTTTTTAGAAAAGTACATGGTTTGCA ATAAATTTTTAAAAACTATTATTTATGTCATTCTAAATAATTAAATGTCATTGTGTCCCTTTATTTTATTCTTATTAATT GAATAATAATTATAATTAGTTTTAAACAAAGTGGCATAAATAATATTTTTTACCATATTCAATATTATTTCTTAATTTTT TCCCCTTTTTTTTTCTTTTAAGCCCACATGGATCAAACCAAGTGGATTAAATTGAAAGCTCTAAAAAAATAAAAAGATAT CTGGATTTAACTTGGTTGTAATTATTTTTAAACAAGCGTATTCTAACTTGATCTAGAGAAAACAAATAGAAACGTTCAAC ACCAATTCAGCAAGACGCTGGATTTTCCTGTCAAGTACATGTAAGAGAGAGCGTACATAAGTAGTGTATACGATTATTTT TAAGTTCCATTTAACTCTTGAGTACTTTCTCTAGAAAGACAAAGAACGGTGATAATTAAAAAAAAAAAAAAAATTAGTCT GATCATTAATAAAGTACTTTTAAATGTTATATATTGTCTCATAAAGAGACAAGACGGCTAAGTTAGCTAGCAAATAAAGA AGATGTCTTTAAAAAAAAATTCATGTATTTAATTACCACAGGGCTACTTGAATCTAAATTAAGTGGCATGGTTGTTATTC TTATTTTTATTTAGAAATATATATATATATATATATATATATATATATACTAGTAAAAAAACACGCATTCCGCATGCGAG ATTCATTTAAAATAATGATTATATAAACTGTCAAAAAATAGGAAGAAAAAAAGTAAAAGAATAAGAAATAAGAAGGCCAA GAAAGACAAATCTAAGGAAAAAGATTTGAAGCAAAAGAGAGAAAAAAAAAGAAAAAAAAAAACTTGTGGGAAATATTTCT CACAGACAATAAAGGTTTATGTATGAACCCATTTAAGATTAAATTAATTTAACTGGGTAAATAAGAAAAAATAATACTTT CGATAACAGTAAAAAAATATTTAAATAAGATATATTTAAAAATATATCAAAATCAAAAGTTAAAAGATGCATTAAAAAAG ATGGGGGAGGAAAAAGAAGAAAAGAAAAAAAAAACAAAAAAAAGAAAAAAAGAAAAGAAAAATAAAACGTAGAGTGCATT GAAACAGCCGCTCCCAAAAACGGATTGCTCCTTAATAGTTAGGTAAAGATATATAAATATATATATATATATATATATAG AAATAACTACAAGTTAGAGATTTCTTATCTGAGCTCTAAGTCGGATTGTATCCGGGTTGTACTAAGTATTCATCGTTGAA TTTTTTAGTGAAATTAGTGCATTTAAAAGTATTGTACAGATGTTGAAGCTACTGAGAGATGCACTTCCTGAAGGCAACAA GTTACCTATATCGCATTACGAGGTGAAGAAGTTATTGAGTAAACTAGGTCTGAGCTACAAGGCAATTCATGTGTGTAAGT ATGACTGCTCTTTGTTTTTGAAGCAGAATACTATTTTGCAGTCTTGTCCAGTATGTAGTACAAGTCGTTGGAAGAGCAAA GAGGGAAAAAAGTTCCGTGGAAAGTACTCTGATATTTTTCTTTGAAGGATCGGTTGAAGCGTCTATATGCTTCCCATCAC ACTGCTAAGGAAATGACGTGGCATGTGCGGGGACGTGCGGGGGCGTTGAAGGATCGGCTGAACTGAGAAATGTTCGATTA TGGTTAGCTACTGATAGTTTCAACCCATTCGGGAATATGAGTCTATCATACAATATGTGGCCTATTATTGTGACTGCATA TATTTTACCCCCATGGCTATGTATGAAGGACCTATATAAGATGTTGACGTTATTGATTTCTGGTCGTAATGCTCCTGGGA AAGATATTCATGTGTTCTTAAGGCCCCTTACATATGAGCTAAAGGAGTTGTAGGATGAAAGAGTTGTTATTCGTGATGTT GCTGCGAATACGTTATTTCGGATGCGAGCTGTGTTACTGATGACAGTTAACGACTTTCCTGCGCGTAGTAGTTTTTCTGG TTGGAGTGGTCAAGGGTACTACGCGATTGCAACGATGCAGCTCCATCGAAGCGAATAACCAGTAAAATTTGCTTTGTTGG GCATAGACAATGGATTCCTATGAGTCATAGGATGAGGACTAACCAAAAGTTCGATGGTAAGGTTGATCGATGACCTCCCT CACCTCAGAAATCTATTAAGCAAATATTAGCTCAATTAAAAAGGGTGGAATCTCGATTGCCAAGTAAACATGAAAAATTA GGCGAAGAAGAGTATCTTTTGGGACGAATTTTTTTGCGACAACAGTTTTAATAATGTGGTCGCAAATAACTTGGGATTTT AATTTTCCAAAAAAACAGGGCAAAAACTTTGGCAGTTTCCTTAAAATTATTTGCGACGACATCGCAACAAAGTCGTCACA AAAAATGAGCGCAGGTATATTCCTCAAGAATATTCTAGAAATATTAATGAGGTGAATAAGAATGATGTTGTTTTTCTATA ATTCTAACGACAATTTCATATTTTTTGCGATGACATATTGTCGTCGTCAAAAGCGACCTGTATAAACGTGATCACAGATC TATTTCCTCCATTTTTTCCGGCTGTCTCTCTCAGTTTTCTTCCTCCCTATCCATCCAAAACCGTCACATACCGTCCAAAA CCTCCAAAAAAAGCTTAAATAATACTTAACTCTTTCTTCAAATCCTTCATTTGTACCGAAAAATATTGCGGAAAAATCCA AAAAAATAGAGTTATTTCTCGCCGTCGCCACCCCTTAATCCGACTGTCACCGCCCCATATTCCGGCCGCTGTCGCCCTCC CATTTTGCTGCCTTACCATTCTCCAACCCCCGATGTTTGTGAGATTGGATTTTGTGAGTTAATATTATGGTATTTTGTTA ATTAATTTTGGTATTTTTGTTATGATTTGTGGTTTTATTTTAGATTTAGGATCTAGTTTGTGGTTTTGAATTTAGAATTG TGAATTGTAAATTAGATTGAAATTTGTTTAATGATGATTATGTGATGATTAAAAAAAATTTCCAAAAAAAGGGAAATTAG ATAAAAATTTTCATAAATAATGATTATTATGTGATAATTAAAAAATTAGATAAAAATCTTAATTAATAATTAAATAATTA AATAAACTAATGTTAAATACTTATTCTAAAATAATTTGTGTTAATTTTCATAAAATTTGATAAAACTTTATAAATTCTTC GTAGTGGAGATGCCTATGGACAAGAGTTATATATATTTAAAGAACCGGTTGTCTGATGAGTAATGGGATGGTTTCTGTGC TTTTATTGAGGTTGGAAAGAATTATGCAAATTCCCTCGGGGGTATTAGTTGTCCGTGTATGAACTAGTGTAGAAATCATG AGGTGCATCCACCCAAAACAGTGAAAGCGCACATGTATCGATGGGGTTTTGATACAAGATACACTACATGGATTCACCAT GGTGAAGTACGTCCCGCAGCTGCAATTTTCAATGCATCTGTTGATGAGATATTTTCAGTG >DTC_7_2_Mno length=2710;Class=DNA transposons;Order=TIR;superfamily=CMC; AAAAATAGAGTTATTTCTCGCCGTCGCCACCCCTTAATCCGACTGTCACCGCCCCATATTCCGGCCGCTGTCGCCCTCCC ATTTTGCTGCCTTACCATTCTCCAACCCCCGATGTTTGTGAGATTGGATTTTGTGAGTTAATATTATGGTATTTTGTTAA TTAATTTTGGTATTTTTGTTATGATTTGTGGTTTTATTTTAGATTTAGGATCTAGTTTGTGGTTTTGAATTTAGAATTGT GAATTGTAAATTAGATTGAAATTTGTTTAATGATGATTATGTGATGATTAAAAAAAATTTCCAAAAAAAGGGAAATTAGA TAAAAATTTTCATAAATAATGATTATTATGTGATAATTAAAAAATTAGATAAAAATCTTAATTAATAATTAAATAATTAA ATAAACTAATGTTAAATACTTATTCTAAAATAATTTGTGTTAATTTTCATAAAATTTGATAAAACTTTATAAATTCTTCG TAGTGGAGATGCCTATGGACAAGAGTTATATATATTTAAAGAACCGGTTGTCTGATGAGTAATGGGATGGTTTCTGTGCT TTTATTGAGGTTGGAAAGAATTATGCAAATTCCCTCGGGGGTATTAGTTGTCCGTGTATGAACTAGTGTAGAAATCATGA GGTGCATCCACCCAAAACAGTGAAAGCGCACATGTATCGATGGGGTTTTGATACAAGATACACTACATGGATTCACCATG GTGAAGTACGTCCCGCAGCTGCAATTTTCAATGCATCTGTTGATGAGATATTTTCAGTGTTAAATAATGTGGCTGGGATT AGTGATGATTGTGAGACAATGGGTAAGACAGAAACAGTTATAGAAGACATGCATTACAATAAATTTAGAGATTTCTTATC TGAGCTCTAAGCCAGATTGTATCCGGGTTGTACTAAGTATTCATCGTTGAATTTTTTAGTGAAACTAGTGCATTTAAAAG TATTGTACAGATGTTGAAACTACTGAGAGATGCACTTCTTGAAGGCAACAAGTTACCTACATCGCATTACGAGGTGAAGA AGTTATTGAGTAAACTAGGTCTGAGCTACAAGGCAATTCATGTGTGTAAGTATGACTGCGCTTTGTTTTTGAAGCAGAAT ACTGCTTTGCAGTCTTGTCCAGTATGTAGTACAAGTCGTTGGAAGAGCAAAGAGGGAAAAAAAGTTCTGTGAAAAGTACT CTTATATTTTCCTTTGAAGGATCGGTTGAAGCGTCTATATGCTTCCCGTCACATTGCTAAGGAAATGACGTGACACGTGC GGGGGCGTGCGGGGGCGTTGAAGGATCAATTGAACTGAGAAATGTTCGATTAGGGTTAGCTACTGATAGTTTCAACCCAT TCGGGAATATGAGTCTATCATACAATATGTGGCCTATTATTGTGACTGCATATAATTTACCCCCATGGCTATGTATGAAG GACCTATATAAGATGTTGACGTTATTGATTTCTGGTCGTAATGCTCCTGGAAAAGATATTCATGTGTTCTTAAGGCCCCT TATAGAAGAGCTAAAGGAGTTGTGGGATGAAAGAGTTGTTATTCGTGATGCTGCTACGAATACGTTGTTTCGGATGCGGG CTGTGTTGCTGATGAAAGTTAACGACTTTCCTGAGCGTAGTAGTTTATCTGGTTGGAGTGGTCAAGGGTACTTCGCATAT CCCAATTGCAACGATGCAACTCCATCGAAGCGAATAACCAGTAAAATTTGCTTTGTTGGGCATAGATAATGGCTTCCTAT GAGTCATAGGATGAGAACTAACCAAAAGTTTGATGGTAAGGTTGATCGACGACCTCCCACACCTCAGAAATCCGTTAAGC AAATATTAGCTCAATTAAAAAGGGTGGAATCTCGATTGCCAGGTAAACATGAAAAATTTGGCGATAAAAAGCGAAAGAGA CAACCGACAAAGCTTAATTAGACGAAGAAGAGTATATTTTGGGAGTTGTCTTACTGGACCTCATTGTCGCTACATTATAA CTTAGATGTCATGCATATTGAGAAGAATATGTGTGATAGTTTATTGGACACAATTCTAAATATTGACAGAAAAAGTAAGG ATACAGATTAGGTGAGAATCAATTTACAACATATGGGAGTACGTAAAGAGTTACATTTGTATAAAATTGTGATTGATGGA TGAAACCACATGCAGCATACATAAGGCTTATAATTGTTCATATAACATAAGCATTATGTAAATAAGATAATAAGGTTTAT GATGACTTCTTAAGAGGCAATCATGTTTGGCCCAATCTCTACATGTGCTAGCTCTTCAAGGGGACCGCAGCCTCCACCCG ATCCTTATAGGTTGCCATCACACTGTGAGTCTGGTATGTTAGAACATAATTATAAATTTGTTAAATTAATTACATCAGTA TTATATGATTACTAAATATATTTCATTCTACAGCACCCGATGCCGCACCTCGATGACGTCGTGGAGGTCAAGGGAAGGCT AAGGGTCACAAAATCGCAACCAGAGTGGCAAAGAAAGGAAAGATTACCCCTATGTTTGACGAACGTTGAGGTACTTGGAA GGCAGTTGGAAACTACGGCACCTGGATCGATAGTGCAATTGGAATCCATGTTAGGGATGTCTGTGAGCCTTTCCATGATG CCTAGAAGAACGTGGACATCCAGCATAAGAGAGAGATTCAGCAGCGCCTGCCGGTATAAATTATTCAACT