>DTC_6_1_Mno length=8422;Class=DNA transposons;Order=TIR;superfamily=CMC; CACTGGTAGAGTGTAGAATGTTGATTAATGCTTCCTTTTCTTGTTTATATAATTTTAATGCATCTTTCCTAAGAGTAGTT CTAGAAAAAAATTGTGCATTAGGATTATGTACAATTTTAATATAACGCTGTCAATTTCTTTGTTAAATAAAACTTAGTGG TTGATCTAATGTGGCTATTAATCATGTCATTTCTATACAATCAACTTGCGGATCGTATTTCCACGTGCTTAGACGGCCGG TTTGACGGTCAAATGATAATTGTGTTTGGCAGAGATCAGCTCCGCCTCCTTGCTTTTGAAGACACTTTTCAGAGTGTCTT TTTAAGTGTGTAGTGTCGTGAATAGTGTTACCTTATAATTTCTCACCACAATATTTACATTGAGCTATGTATTTAATGTT ACCGTTATTGTCGACCTCCTCGAATGTGTTGAAGTACTCCCAAACTGCTGAGGTATGTCTACTAGGGGTCGGATTTGCAG TTTCCTCAGCAACTCTTTCCGTAGTTTGTGATTCCTGCGTTTGAAAACCATTAGGAAATTGCCCTTCTTCAATGTTGAAT TGGGCATAATGGGAATATCACCACCATAACTAAAAGAAGCCATTATGAAAAATAAGAGAGATTGAGAGCGCTTTGAGAGA GATTAAGAGAGATTTAAGCGAGATTAAGAGAGATTTGAGAGAGATTAAGAGAGATTAAGAGAAATTGAGTGAGAATGAGA GTTTTTGGGTGAGGAAAATGGTTGGGGGGTATTTATAGGAAAATTTTTGGCTTGAAAAAAAAAAAATTTTCCCCCAAAAA TTTGAGTCCAACAGCTAGTAAATTTTTCGGGCAGTCGGGTCGGGTCAGGCAAGAATCGGGCAACGGTCTAAATTATAGCC GTTGGGATTTGAATTTTCAGACAAAATTCAGGCGGCGGTCGGGTTCAGGCAAAAAGATCCGTTGGGTTCAAAATTCGGGC AGAATTCGGGTTAACGGTCAAAAAAATTCGGGCAACGGGCAAAATTCGGGCACATTTAGGTTACGCCGGAAAATTTAAAA AAAATCTGGCGGACGGCGAGGACGACTTCTCCACGGTGGCGGGCAGTCGGGGAATGAATTTTTTCAGACTGCCCGAGCCC GTGCCCGACTAAAAACCTCGTACGGGCGGCGAATGGCACCTGCCCACCACCCGAACTTGCACCACTAATTTCAATTAAGC TAAGATTTTGTCAAGAAAATAGCCCAAGGCTGCAATTATGTACGCATGTCTTCCATCATCACTATCGGTTTTACAGAATC AATATCTACTATCTTATTTTCTGTTTTTATTGGCTGTCTCTACAATTAAATTTTGACTCATAAATTACTTGAGTATTTTT AGTACTTAATTTCTATTTATGTAGTTAGATTGTTAAATTTAAATGACGTGATAAATAAGTGGCGGATGAATATCTAATTA GACAAAAAAATGAGGGACTGGGTTTCACAATCCGAGTCACGGGTCCTATATATGTGGGGGTGGGGGACAAGCACCTTTTG AGGCCAGTGTAGTACGAGAGTGACATGAGTATTAAGTAGTCTACTCTAGTACTCGTTAAATATACATCATACAACTTTCA TGTGCCCAAAGATATTGGACCTTAATTGGTGATTTACGTCAAGTTAAAAAATCCACACCATACTATAGCACAAAATGTTA CCCCAATGAAGTTAATGCCGTGAAAGAAGGGTCCAATAATATCGTGGTTTCCTAAAGCCAAGTTCAACTAATTGCAGTTC AGTTCAGTGAAAAGAGGCATTACAAAGAAGGAATGAGATGAGTTTGGGTTGGCCTTTGTGATTTTGTAATTTTGGGCCAA GATGAAAAAGTTTGGCTTCTTTTATGTGGGCTCAGTCCGAATCTTAACATGAGAATGGAGGCTGAATCACACGGGTGTGT TTAGTTGGGTGGAAATGAATGGAATGAAATTTTAGTTTGATGTTTGATTAGATTTAAAAAAAAAAAAATGATCATTCAAA ATGAATGACTATTCACATATTTTAACCGAATCATCATTCCTTTCTCATATGAGAGAAATGACAATTCTGAGTTCTTTTTT TATTCTTTTCTATAATTACCCTTCAATATTATAATATAATTAAAATATATTATATAATAGTTATATCTTATAATAGAATA TAATATAATATATAATAATAATTTTAGTATATTATATTATATTCTATTATAAGATATAACTATTATATAATATATAATAA TAATTTTAGTATATTATATTATATTCTATTATAAGATATAACTATTATATAATATATAATAATAATTTTAGTATATTATA TTATATTCTATTATAAGATATAACTATTATATAATATATAATAATAATTTTAGTATATTATATTATATTCTATTATAAGA TATAACTATTATATAATATATAATAATAATTTTAGTATATTATATTATATTCTATTATAAGATATAACTATTATATAATA TATAATAATAATTTTAGTATATTATATTATATTCTATTATAAGATATAACTATTATATAATATATAATAATAATTTTAGT ATATTATATTATATTCTATTATAAGATATAACTATTATATAATATATAATAATAATTTTAGTATATTATATTATATTCTA TTATAAGATATAACTATTATATAATATATAATAATAATTTTAGTATATTATATTATATTCTATTATAAGATATAACTATT ATATAATATATAATAATAATTTTAGTATATTATATTATATTCTATTATAAGATATAACTATTATATAATATATAATAATA ATTTTAGTATATTATATTATATTTTATATTTTATATTGATAGATAAAATATTAGTGTTATATATAGTATAAGGGTAAGTT TGTCAACATGAAAATATTCATGTTTCATTCCAGAGAATTTTTAAAATTACAACCAAACAAATGAATCAACTTTGTTTTTC ATTCCATTCCCATTACCATTCTCATTCTCATTCCCATTACCATTCCCTCACTGTAACCAAACGCACCCTTAGAGAGATAA CCTGAAAAAATGAATAATTTATCCGTAAAAGTGCATGAGATTTTTACTCATTATTCTTGATAAATATTTTTTTATTAGTG TAATTATTTAACTGAAAAAGTTATGAATCAAGAGTAAATGATAAAAATCTTAACCCATACATTTTTAAAGAGTATTTGTT AAAATTATCCTTTTACTATAATATTTTCTCATGTAAAAAAAAAATTAAATTTCTATTATATTCAAACCCACAAACCAAAC GAACTATGCATTTTTAGTTGCAAAAACTTTTGGTGCCATATATTAAAAATGGAAGGAAGACTAAATTTTTATGACTAAAA TAACTTAGTCACTGAAAATAATATTTAACAACCAAAAGTTGGTCACTAAAGATTTAATGTTTTTTGCGACTAAACTATTA GTCATTGAACAACATAAAATCTTACAATTTCAATGACCGAAACACTTTTAGTCATTAAATTAATAAACCACTTAGATCTT TTTTTAACGAAATATAGTTTTTTTATATAATCAATTAAACAATTAACCAACTAAGATAAATACCCATATATATATATATA TATATATAAAAGGAAGAGGTTGATTGAGATGTGGGTAATATAACGAAAAAGAGGAGATTTTCATGCTTTTCCGCTGATTC TGCGGCAAGGAATTATTATTATTATATTTTTTTAGTAAAGCAAATTATTAAAAGAGGAATAAAAGAATAAAAAAAAGTTT GGATAAGTAAGAATTAGTTGGAACCTTTTGAATAATTATTAATTTGAAATTTAATTACAATTTTATATATATACCCACAT TATATACATACTATGGTGACTTCGGCTGTTGCCGAAGTCACCACAAATTCGGGTTGACGAGTCTTATTAATTTATATATA TATATATATATATATATATATTATAAAGAGAGTGAGATTAGGTTTTGACATAGGAAATCTCATATCTGTATATATGCCTA AAGCAGTAGGTTTCCTATTAGGTTTTGATCTCATATCTGTATATATGCCTAAAGTATTGGCATAAGTCTCATTCTACTCT CTCTTTCTCCCTTCTCTTTATATGCGATTTTGTCCCATCACTAACGCTTAAATAATTTCTAAGAGAGACTCCACTGCTGT TCAATTCTGAAGCCATTATCTTTTCTCTCACTCTCCTCTCTTAACGCCGCTTTTGAAGAATTCTTTTAAGGATTTTATTT GCTGGCTATCATGTTTGTTTAGGGAATTTTTGTTTAGATTCTAAAGACTTGGAAGGCGCAAAAAAAAAAAAAAAAAAAAA AACTGGTAGTTGAAAGGCACATAAATATTTTTATTATTTTTCTCATAATTTTAAGCAAGAAATAAAAAAGGAGTCAATTT TCTTCAGCTTTCAGTTGTTTAATATTGAAGGAGAACTAAACACCTCTTGAAAACAAAAGACTCCTCTCTTTAGTTTCTTC CACTTCCATTTCTGATATGTTCAGAGAATCAAGAGAATTTGGACAGAATTTTGCCGCTCAGCTGCAAATAACAGGCAAGT TCTTCACTTTTTTTATTGATGTAATATCTTTGTTTTGTTGTAATATCTCTTTTCACCGCTTCTTTAATATCCGAGAAACA CGGATAATATTTGTGTGTAGATATGTATTTTTTTGGTTTCTCCTTTGTGTTTTGGCTAAATCTATGGTTAATTTTTTATG GGTATTCAGTTATTTATCTTAATTGTTCACCGGTGTTTTCATATTTATGAATTATTGTTTGAAGGTTTAATGTTATGTGC CTTTTAAGGATTTTGTCCTATCACTAACGCTTGAATTTTTTTTTAGATTGTACTCGAGAAGAATTCTAGAGTTTGGCTTG ACATATAATTCTCATGATATGACATGAATGAGTTTCTAATGAATTTGAATTCTAAGAATATTTAATTCCAGTATTTTAGT ATTGTTTTAGAATTTTTGGATTTTATGAATTTCTTATTATTTAAGACATGTTTTGTAAAATCCGTTTTAAATGTCAAAAT TGAGTATTTTAATTTATAAAAATTCTGAGATTGCTATTGATATGTTAACCAATTTTACACAAAGTTTTAGTCTCTGATCA TGTCTATATTTTTAATTAAAATTCGTTGACCATTATGTACTCTGTTTGATCAATATATACATGCATGCTTATGACTACAG CATTGTCAGACTGTAATTGCTCTTTTATGTTGCTGGTTTGTTGCAGCATGTTCCTAGAACCAATGGTGAAATACCCTCGG TCGATGAAGCAACTGTAGATCATCAAAGGCTTTTAGACAGGTATTGTTTTTTGCTCATCTGATGATATTTGCTAGATTTT TTTGTAAAGATACTTCTGCATTAAAGCCTACTAGAATAGGTTTTAGCTTCTAGTTTGTCAACTAAGTAAAGTTGTCCTGT TGCTCCCATGGACTGATGGCGTTAGACTTAACTTCTTCTTACAGTTGAATTTGTTATAAGCAGTTAACGCTTTCAATCAT GGACAAGAATTGGATATGGAATAATAATAAGTTATCACAAGAATATACTGATGGCGTCAAGAACTTCATTGCAATTGCTC GCAATCACTTGAACAATGACAATAAGACTCGCTGCCCCTGCATCGAATGTGTAAACTTCTTCTTTCATGATATAGTAACA ATTGAACGACATCTATGGTTTTATGGTTTCTCTAAACATTATACGAACTGGATATATCATGGAGAGGTTGACGTCAATCT AAAATCTAACAATCAAGAAGAGGTTGTTTCAAACATGAGAGACGATAATGAAGGTTCTGATAGTGACGATATGATACCAG TACTTGAAGATGCAACTGGAGGAATTCCCCAAAGCAATAATCAAAATGAGACAACTTTAGGAGAGTAAAGTCATATTGGA CGCGACAAATTTAAAGAACTATTTGAAGAAGCAACTAAAGTACTTTATCCTGGTTACACGAAGAATTCTTCTCTTACAAG CATTGTCAAGTTAATGCATGTGAAGGTGATGAACAATTGAAGTAACAAGTCATTTGATATGTTACTTCAAATACTTAGAG AAACATTTCCAGGCGGCGATAAGCTTCCAAGTTCCTACTATGAAGCTAAACGAATGTTCCGTGAACTTGGTTTAGGCTAT GAAACAATTCATGTGTGCGTAAATGATTGTTCTCTATTTTGGAAACAACACAAGGATGCTGAAAAATGTGCTATTTGTAA TGAACCAAGGTACAAACCAGGTCGTACGAAAGGAAAAAAGATACCAAAGAAAAAGATGTATTATTTTCAAATTACTCCTC GTCTACAGAGACTTTTTATGTCAAGACACACATGTGATGATATGAGATGGCACAAAGAAAAATGTGTCAATACCGAAGGT GTGCTTAGACATCCTGCATATGTTGAGGCCTGGAAGGAATTTGATCAAGAATATCCATGGTTTGCAGAGGACCTAAGAAA TGTTAGATTGGGACTTGCAACTGATGGTTTCAACCCATTTGGTAGTCTTAATGTCAAATATAGTGTGTGGCCTGTTATTT TAGTACCATATAATATGCCACTTTGGAGATGCATGAAACAAATGTTTTTTATTATGGCGATATTAATTCCCGGTTCCAAA GCCCCTGGTAAAGATATTGATGTATATTTACAACCCTTAATTAATGAGCTGAAAGAATTATGGAAAAATGGGATTAGAAC GTACGATGTGTCAAAAGATGAATATTTTACGATGCATGCTACAGTTTTATGGACAATCAATGACTTTTCAGCTTATGGTA CAATATCAGGGTGGAGCACAAAAGGTTATAAGGCATGTCCTGATTGTAATGAGGATGGAACATCCTTCTACATTAAGGAC AAGATTAGTTATATGGGGCATCGTCGATATTTACCTATGGATCATCCGTGGCAGAAAAGTAAACGTTATGATGGTAAAAT TGAACGATGACCTCCTCCTAGAACATTCACAGGTGATGATATCTTAAGGCAACTGGAAAAGGTAGAAGAATTTATCCCAG GAAAAAAGATCGTAAAAGAAAAAGAAAAAAGAAAAGGTGATGTGCGTGGTAAGAAAAGAAAACGTGTTGTGCTTGCCAGG AAAAAAAAATAATGATGTTCCAACAAATAATTGGAAGCGAAAATGCATTTTGTGGGAGTTAGAATACTGGTCAAAATTGA AGCTAAGACATAATTTAGATGTGATGCATATTGAGAAAAATATTTGTGAGAGTCTATATGGGACAATCTTATGCATGGAT GGAAAGTCGAAGGATACTGACAAAGGTCGGCTTGGCTTGGCTGAATTGAACATACGAAAAGAATTGCACTCACAACAAAA AGGTGATAAGTTTTTTAAGCCCGTAGCATGTTACACATTATCATTAAAAGAATGAAGAAAATTTTGTGAGTGGTTAAGTT CTGTCAAGTTTCCAGATGGTTTTGCTGCAAACATTTTGAGAAATGTGAATATAAGTGAGGGGAAAATATCAGGTTTGAAG AGTTATGATTGTCACATTTTATTGTAATGTCTTATTACCCCTGGGTTAAGGCCTTATATGAAAAAGGAAGTGATTGTCGC AATTTCTGAACTATCATTATTTTTTCAGAAGCTATGTGCAAGAACATTGTATGTTACGGACTTGGATGCCGATGGGATTA TCAAGTGTATGTGTAAGCTTGAATCTATTTTTCCCCCATTATTTTTTGACATAATGGTTCACCTAGCTGTACATTTACCT TATGAAGCAAAGTTGGCTGGTCCAATACACACACGGTGGATGTATCCGTTTGAAAGGTAGTATCGTATACTTTATCTTTC CAACAACACGTCTAACAAAAAATAATTATTATTAATAAAGTGTCATGTCTATTCTTAACCAGGGCACTAGGTACTCTAAA GAAGTATGTTAAGAATAAGGCTCGACCAGAAGGATCAATTGCTGAAGGGTATATCATCAATGAGGCATTAAACTAGTGTT CAATGTATCTTCATGGAATTGAAACTCAGTTCAATTGTTCAGAGCGGAATTCAGACCGTGTTGAAGAGCGAACAGAACCT ATCTTATCAGCTTTTGCTCAACCTACAAGATTATTTGGGAAAAAGGAATCATTACACTTAAGAAGTGATTTTGATTCTGA ATACGAAAATGCACATTGGTACATTTTAAACAATTGTCCTGAAGTGCAACCCTATATTGAGTAAGTTTATTCACAAACAT TAGTATCATTTTCTTTCTTGGATTTTTGTTTTTTGTTTTATATTTTTATTTTATTTTATTTCATTTTATTTTTACTTGTT TTCTTGTTTTGTTTTGTTTTTTTTAGTTTTCAATTTTTTTTATTTTTCTTTTACTTAAGAGCCTCCTACAATGATTAAAG TATGATTTCATGTCAAACAGTG >DTC_6_2_Mno length=7862;Class=DNA transposons;Order=TIR;superfamily=CMC; CACTATGTATAGTTGATTAATTAATTAGTTTGACCCTTGTACTATACAAATATGTATTGCATATTACGAATACAGTGAGT TTGGCAACAGAACAATTAACTTGAATTCGAACATCCCCACTTATCATACAACTTGTTTATAATTATATATATATATATAT ATATATATGATTGAACTGAAACGAACGATAGTATGTATGAAATTATGTAATATCTTAATTTATATATAAGTGAAGACTTA CCTACTTTTATTCATAGTATAACATAATATATGTATTTATATATATTAACCTGCTAAAAAGGGTGTTTGACGTTTCACAA TTAGCCAAACAGGCCGGCTGGAACCTATATAATTTCACTAATTTTTAATTAATAAAATTTACCTAATTAAACGTACCACT AGATGAACTGAGATTTGTTCTTTTATCACTTCCATTAATCACACGTAACTCAAGATTGAACAAATTATAATTAGCTTGCT AGCTAGATGAGGACATGATGAGTATTAATATTTAAGGCAAATCGACCAATCGGAAAATGCCGTCCTATATTGAAATCTTG AAATCTAGCTAGCTTGCGTAACGCAATCCTTTTGATTTATGATCATGAGTTTGTTGCATGCATATTTCAAATCTGAACTA CTTTGATTTTGGTTGAAATATTCTCATAATCTCATGCACACACGCAGATCGCAAGCAAAATTCCCTCACGTACAAGGCAC TTAATGATTCTCATGCATGTTCAGCACTTTATATTATCTTTTTTCTTTATACAACATATAATATTATAGCTTCCCGTATA TCGCGTATGTATCCGCTGATATAGATTTGGAAGTTTCATTTTATTAAACGAACTTTTATGGAATTGTTCACTAATATCGG CCTCAAGGTTTAGGCGCTCATTTCAACTAAATTAGCATTAAGCAACTCGGACTCGAAAGGCTGTATACATATGTGTGTAT TAACTATAATTATATACATATACATCCTCCAACGTTATACACGTTATGTATGCTCTCATTTTAGCTTCCACCATATGATC TGTCGATCAAGATTCAAATTCTGGTACTGATATAATAAACATTAATTCCGAAATTTTTCACATTCAAGACTCTTAAATAG GGTCATTCTCAAACCTTTCACCACAACCCACCACGGTAATCTATTACCGCTAGGCCACTCCACTCGGAGGTATTTTACCT TTCTATTTAACATGAAGTAACCACACCCTAAATGCATTAATGTAGATGCAGTTGTGAGATCTTCATTCTCAGTTACTGCG GATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTATTGCTGTTTTAGAAGGAAAGC ACGGTACAGCAAGATACATGTATTAGTATTCCACTATGCATGCTTGTAAATATAGCTTAAGCATTTGGCCCCAAACAAAA AAATGAAGACATAGCCTAGATTCAAAAATTGATAGCATTCAATCCCTTACAGTTTATCTACGGTCCATTAAACAACTATG GAAAATCTATACCGGTAAACACTCATTTCAACGGGTAGAACAGCTTATCAACCGAAATTATGCGCAGGGGCGTTTGGTAG AGTGATTCGTTCCCTGATTCGAATCATGATTCGTGGTTCGCTACAGTATTTTCTCTCACAAAAAATACACGTAAATCGAA AATGGTTCGAATCACATGGTTTGAATCCTCCAACCAAACGAAAATGAGCCTCATCTAACTGCAAGAAATTACACTTTTAG CGACTAAACTTTTAGTGACTAAAACTTGTTAGTCGCTAAATATATTTTTCACTGACTAAACTTTAGTCGGTGAATTATAT AGTCAAGAGGTATATTATTTTCGGAACTAAAATCATCAGTGACCATTTTTTAGTCGCCGAAAGATATATTTAGTGACTAA ATGCGTTTTTAGTTGCAAAAACCTTTGGCGCCAAATATTAAAAATGGAGGGAAGACCAAATTTTTATGACTAAAATAACC TAGTAACTGAAAATAATATTTAACGACCAAAAGTTGGTCACTAAAGGTTTAATGTTTTTTGCGACTAAACTATTAGTCAT TGAACAACATAAAATCTTACAATTTCAGTGACTGAAGCACTTTTAGTCATTAAATCTATCTTTTAGTGACTAAAATTTAG TCTCAGAAAAAAAAAAAAGTAAAAATTTTATTTTGATATCAAAATTAATAAACAAGTAAGATCTTTTTCAACGAAATATA ATTTTTTTATATAATCAATTAAACAATTAACCAACTAAGATAAATACTCATATATATATAAGCTTAAAAAAATAAAGTAA AAGATGTTGCTCTAATTATATAATATAAATAATCCAAAAGCTTTAATGTTAATAAATAGGATACAATTAAATTATTAAAA CTCTATCTCTTTCTAAGCGGTTTTTTATTCTCTATGGAACCCTTAAATAGTTATATTTTTAAAAATAAGAAACAAAGAGG TTATCAAAGAATGATCATCTCACAAAATGAGTCTTTTATAGATAGCAGTCTCAAAATAATATTAAGATTAAAAGTTTAAC ACACACAGTTATTACCCGACACTTTATCCTCTTCTTTACACACTCTCTAGCTAACACCATTTACAATTATTATCTAACAT TTTTTATTTTTTTTCTTTCTTTTTTTCTCTCTTTTTTTTTAGCAAGGTTAGGTTCATATTAACCCAACCACTTAACAATC CCACTCACCAAAAAATACAACGAAATAACCCAACTCATTATCCCCTAAGTCATAACTAACCTCTATAACTGACTCATATC TATATATTTATATATAAATATATATATATATATATTCATTTATATATATTTATATTTTTAAGTCACCCTAATGTTGACCC ACATCCGTCCACATTTGTAAATATTTATTTTTTGAAGTCAAATTAGTAAATATTTTCTCTATAGATTGTCCCTAATGTGA TTGATCAAATGTTACTTTTAGACAATTTTAATAAGCACATGAGATAAAATCAGCAATAAAGAAGTAAGTAATTGATTGAG ATATGGGTAATATAACGAAAAAGAGGAGGTTTTCATGGTTTTCTGCTGATTCTGCGGCAAGGAATTATTATTATAATATT TTCTTAGTAAAGCAAATTATTATAGTTTTAAGGAAGAGGTTGAGATACTAAAAAAAAAAAAGAGGAATAAAAGAATTAAA AAGTATATATGTATAAATATTATAAAGAGAGAGAGGAAGGAAGAAAAAAAAAAGAAATTTCCTATTAGGTTTTGACATAG GAAATCTCTCTTTTATATATATATATATATATATATATATGTCTAAAGTATTAGGTTTCCTATTAGGTTTTGATCTCATA TTTGTATATATGCCTAAAGTATTGGCATAAGTCTCATTCTACTCTCTCTCCCTTCTCTTTATATGTGATTTTGCCCTATC ACTAATGCTTAAATAATTTCTAAGAGAGACTTCACTGCTGTTCAATTCCAAAGCTGCTATCTTGTCTCTCACTCTCCTCT CTTTAACGCTGCTTTAGAAGAATTCTTTTAAAGATTTTATTTGCTAGCTATCATGTTTGTTTAGGGAATTCAAAAGGAAT TCAAGATAAGAATTTTATGTTTTATTGATAGAGGATTTTCATGTATATATGATAAGTGAATTTTTTGTTTAAATTGTACT AGAGAAGAATTCTAGGGTTTGGCTTGACATATAATTCTCATGATATGACATTAATGAATTTCTAATGAATTTGAATTCTA AGAATATTTAATTCCATTATTTTAGTATTGTTTTAAAATTTTAGGGTTTTATGAATTACTTATTATTTAAGACACGTTTT GTAAAATCCGTTTTAAATGTCAAAATTGAGTATTTTAATTTATAAAAATTCTGAGATTGTTATTGATATATTAACCAATT TTACACAAAGTTTTAGTCTCTGATCATGTCTATATTTTTAATTAAAATTCGTTGACCATTATGTACTCTGTTTTACCATT ATATGCATGCATGCTTATGACTACAGCATTCTCAGACTGTAATTGCTCTTTTATGTTGCTGGTTTGTTGCAGCATGTTCC TAGAACCAATGGTGAAATACCCTCAGTCGATGATGCAACTGTAGATCATCAAAGGCTTTCAGACAGGTAATGTTTTTTGC TCATCTGATGATATTTTCTAGATTTTTTTGTAAAGATACTTCTGCATTAAAGCCTACTAGAATAGGTTTTAGCTTCTAGT TTGTCAACTGAGTAAAGTTGTCCTGTTGCTCCCATGGACTGATGGCGTTAGACTTCACTTCTTCTGACGGTTGAATTTGT TATAAGCAGTTAACGCTTTCAATCATGGACAAGAATTGGATATGGAACAATAATAAGTTATCACAAGAATATACTGATGG CGTCAAGAATTTCATTGCAATTGCTCGCAATCACTTGAACGATGACAATAAGACTCGCTGCCCCTGCATCAAATGTGTAA ACTTCTTCTTTCATGATATAGCAACAATTGAACAACATCTATGGTTTTACGGTTTCTCTAAATATTATACGAACTGGATA TATCATGGAGAGGCTGACATCAATCTAAAATCTAACAATCAAGAAGATGTTGTTTCAAACATGAGAGACGATAATGAAGA TTCTGATAGTGACGATATGATACCAGCACTTGAAGATGCAACTAGAGGAATCCCCCAAAGGAATAATCAAAATGAGACAA CTTTAGGAGATGAAAGTCATATTGGGCGCGACAACTTTAAAGAACTATTTGAAGAAACAACTAAAGTACTTTATCCTGGT TACACGAAGAATTCTTCTCTTACATGCATTGTCAAGTTAATGCATGTGAAGGTGATGAACAATTGGAGTAACAAGTCATT TGATATGTTACTTCAAATACTTAGAAAAACATTTCCAGGCGGCGATAAGCTTCCAAGTTCCTACTATGAAGCTAAACGAA CGTTGCGTGAACTTGGTTTGGGCTATGAAACAATTCATGTGTGCGTAAATGATTGTGCGCTATTTTGGAAACAACACAAG GACGCTGAAAAATGTCCTATTTGTAATGAACCAAGGTACAAACCAGGTCATACTGAAGGAAAAAAGATACCAAAGAAAAA GATGTATTATTTTTAAATTACTCCTCGTCTACAAAGACTTTTTATGTCAAGACACACATGTGATGATATGAGATGGCACA AAGAAAAACGTGTCAATACCGAAGGTGTGCTTAGACATCCTGCAGATGCTGAGGCTTGGAAGGAATTTGATAAAGAATAT CCGTGGTTTGCAGAGGACCCAAGAAATGTTAGATTGGGACTTGCAACTGATGGTTTCAACCCATTTGGTAGTCTGAATAT CAAATATAGTGTATGGCCTGTTATTTTAGTACCATATAATATGCCACTTTGGAGATGCATGAAACAAATGTTTTTTATTA TGGCGATATTGATTCCCGATTCCAAAGCCCCTGGTAAAAATATTGATGTATATTTACAACCCTTAATTGAAAAGCTGAAA GAATTATGGAAAAATGGGATTAGAACGTACGATGTGTCAAAAGATGAATATTTTACGATGCATGCTGCAGTTTTATGGAC AATCAATGACTTTCCAGCTTATGGTACAATATCAGGGTTGAGCACAAAAGGTTATAAGGCATGTCCTGATTGTAATGAGG ATGGTACATCCTTTTACATTAAGGACAAGATTAGTTATATGGGGCATCGTCGATATTTACCTATGGATCATCGGTGGCGG AAAAGTAAACGTTATGATGGTAAAATTGAACGACGACCTCCTCCTAGAACATTCACAGGTAATGATATCTTAAGGTAACT AGAAAAGGTAGAAGAATTTATCCCAGGAAAAAAGATCGTAAAAGAAAAAGAAAAAATAAAAGGTGATGTGCGTGGTAAGA AAAGAAAACGTGTTGTGCTTGCCAGAAAAAATATAAATAATGATGTTCCATCAAATAATTGGAACCGAAAATGCATTTTG TGGGAGTTACAATACTGGTCAAAATTGAAGCTAAGACATAATTTAGATGTGATGCATATTGAGAAAAATATTTGTGAGAG TCTATATGGGACAACCTTATGCATAGATGGAAAGTCGAAGGATACTGACAAAGGTCGGCTTGGCTTGGCTGAATTGAACA TACAAAAAGAATTGCACTTACAACAAAAAGGTGATAAGTTTTTTAAGCCCGCAGCATGTTACACATTATCATTAAAAGAA CGAAGAAAATTTTGTGACAGGTTAAGTTCTGTCAAGTTTCCTGATGGTTTTGCTGCAAACATTTCGAGAAATGTGAATAT AAGTGAGGGGAAAATATCCGGTTTGAAAAGTCATGATTGTCACATTTTATTGCAATGTCTTATTACCCCTGGGTTAAGGC CTTATATGAAAAAGGATGTGATTGTCGCAATTTGTGAACTATCATTATTTTTTCAGAAGCTATGTGCAAGAACGTTGTAT GTTACAAACTTGGATGCCTTGCAAGATGGGATTATCAAGTGTATGTGTAAGCTTGAATCTATTTTCCCCCCATCATTTTT TGACATAATGGTTCACCTAGCCGTACATTTACCTTATGAAGCGAAGTTGGCTGGTCCAGTACACACCCGGTGGATGTATC CATTTGAAAGGTAGTATTATATACTTTATCTTTCCAACAACACGTCTAACAAAAAATAAATATTATTAATAAAGTGTCAT GTCTATTCTTAACCAGGGCACTAGGTACTCTAAAGAAGTATGTTAAGAATAAGGCTCGACCAAAAGGATCAATTGCTGAA GGGTATATCATCAATGAGGCATTAAACTATTGTTCAATGTATCTTCATGGAATTGAAACTCATTTCAATCGTTCAGAGCA GAATTCAGACCGTGTTGAAGAGCGAACAGAACCTATATTGTCCGCTTTTGCTCAACCTACAAGATTATTTGGGAAAAAGG ATTCATTATACTTAAGAAGTGATTTTGATTCTGAATACAAAAATGCACATTGGTACATTTTAAACAATTGTCCTTAAGTG CAACCCTATATTGAGTAAGTTTATTTCACAAACATCAGTATATTTTTGGAGTTTTGTTTTTTTACTTTTCGAATATTTTT TTATTTTCTTTTACTTAAGAGCCTCCTACAATGATTGAAATATTATTTCATGTCGAACAGTGAACATTTGAAATTATTAC TATCCAAAGGCACCATAAATATCCTTCAAGCCCAACAATCACAATTTTCATCTTGGTTCAAGAAAAAAGTAAGAATGTTA TATATAATAGTTTGTCATTGTTCTATTACAAGTATTTTCCGCACTAACATTTGTAATAAATGACAGATCGAAACAACACG TAAATCATCACCAGGTGAAGTGAGTGAGTCTATGTATGCTCTGTCATGTATGCCCGATTATCGAATTGATCAATATGGCG GATGTATAGTAAATGGAATTTGATATCATACAGATCAACTCAAAATTACGGTGTTTGGGTAGAAGGTGAACATAATGGCA ACACATGTGATTTTTATGGTATTATAACTAATATTTGGGAGCTCACCTATTTATTAAACCATAAAGTGGTACTATTTAAA TGCACATGGTATAAGACTGAGGGAAGGAATAATATACATCAAGAATTTCATATTACCAGCATAAATGTAAGCTCGAAGTG GTATCAAGATCAACCGTTTATCCTTGTAAACCAAGCAAACCAAGTATTTTATTTGCGTGATGACAAGCTCGGCTCAGAGT GGAAAGTTGTGGAAAAGGTACATCATCGTCACCTCTGGGATATTCCAAAAGTTATGCCTGAAAGTGCACACGAATGCAAG GAGGATGCTGATTTTTCTAGTG >DTC_6_3_Mno length=5997;Class=DNA transposons;Order=TIR;superfamily=CMC; CACTAAAATTAATTTTTAATACAAATAAAAATTAATTTTAAGAGAAAAAAATAATACCAAATTAAACCATAATTTGCCAA TAAATTTGATGAAAAATCGTAAGGAAACAAGGTAAATTGATAAAAAAAAAAAAGTAAAATTGAAATGACCCATCACCTTC TCTACTTGTCACACGTGCTCTGCAAGAAAATGAGTAGAAATAGAAGGACAACAACGTATTTTTATTAACTTTGTTTTGTT TTGTTTTTGCATTTTATTTTTACCATTATTATTATTATTAGTAATATATATATATATATATATATATATTTTTGCGCTCG GATGAATTTTCAATTGATCGATCACCTTCTTCTCGTTTATGTCGGATCGACTTCGTACACCGTAATATCGTATAACACAA AATACGTACTTCTCGTTTAGCCTTAATTGACTTGAAAAACTAAAGCAGACTACCTATCACTTTAATCAGAAAACGACATG ATACTTTACATGAAAAAGGACATGTCGTCAGCATGCCAAATTGTTCGAAGAGAAACGACAACAAAAAGTAATTTCAATAT GTTTTAGAAGTATGCTTGATAGGTGAAGTCACGTCGTTTTTTTATCCAGATCACAGACAACTTCTTAATATGTCAAGAAA TCAAGTAGGCTGAAATTCCAAATTTTTCTCTTGCCATTTTTACAAAATTTCTTCATATGAACAAAAAGATATATATTACT AAATATGGCACACACAAACCAAATATCAGTACGTTATGTATCTTCACAAGTGTCATAAAAAATTATCTTGATTCTTCGTG TTAGTTATATATATATATATATATGCACCATATCTATAATCTGAAATGAATTGGGATGTTTGCTACTTCTTATACCTAAT TCATTTAGTATGATTAAGGGAAAAAATTTGTGTTACATATTATTAAGTATTGTATCATGCAACAAAACTTAATATGTCAA ACAATACAAAAAATTAGTGCCAGAAGAACAGGACTAATTCTAACCACAGGGATGAGCGCTTGGGAGCGGATGAACCCGTG TCCCTCTTCCATGTCATTCGTGCCATCTTTTCCACCAACCTTTCACTCAAAGCACCGAAGCATCGCGGTGACGGTCTGAA CAACCTACAATCCGAGCGAGGTTCCAGGACATCCTCTTCTTCCGCTCCCAAATGGCAGAAAATGGAAATTTTGTCCCCTC ACGTCCAATTGGCTCTTTCCAATGCCTTCTTCACTAAGAAACCTTTCTGGCTTAAACTTAAGCTGGTCTTTCCAGCACTT GGCCGATGGCCCACACATTGACGAGCAAACGAGTCTTTTCCGCAATGTCATAGCCACTAAGTTGCATGCATCCATGATGT AGCAGAAGCTTAATTAGAAAAATTAGAACAATAAAAATACGAGTGATAATCAGTTAATCTGTTGATTCACACAGAATATC AAGAAAATACTCCAAAAATCGTGAATCAACAGAATACTGGAAATTAGAAGAACATTGAGAGAAATAAAAACTAGAAACTA GCCTATTCTATAATTAAAAATAATAAAAATACAAAATTTTCTAAAGAAGAAAAATTTTGAATTGGAAACAAGAATTGAAA CTCTTATACACAAGGAAAAAGAAAACAGAGGAATCCGAATTTCTTAGGCCAACTTATTACAAAAATGAAAATTATTAAAA CTGGTAAAAAGGCCTTTTGAAGGCATGGAATTTGCCCGAAAAAATGTTAGACGTCATGGTGAGGTAATGAGTTTTATCCG TTGGCCTTTTCTACCCAAAAAACATATATTTTTTATCTGAATCCGACATCGCCAAAAGACATTGTGAAAATAAAAAACTT TACCATATTTAGCTTTAGATGTTCTCAACATGCCATAATGCTAGATCTTTCTGCACCGGATCAATCCACCATATCATGCA ATGATCATCCCCGTGTAAGATATCTATCTTTGGTACTTGATAAAAGTTTGTGGAATATTTTTTTTCTTAATAAAATTGAA AACTAAATACATTCTTTCAGTGCTGTCAATGATTTGAATCGAATAAATAATGAACTGATTCGAAACGACGTTTGGTTGGA GGATTCAAATCATGTGATTCGAACTATTTTTGATTTATGTAAATTTTTTGTGAGAAAATATTATAGCGAATTATGAATCA TGATTCGAATCAGGAAACGAATCCTTCTACCAAACATCTATTTAATATCACGTTCACGGCTGTGATACCAACTATTGGAA TTATGCAACGTTCCAATAAACTGATTTGAATCGAATAAACAATGAAGAACATACCAAGCTCTGTATTGAATCAATAAATC AAGAATAGTACACCCTCCTCTCTCACTTCTTCTGTGATCAGGATATCACAGAAAGAATCACTCTCTTGTTCTAAAATAGA AAAACACACCAATCCAATCCCTAACATTCACATTATAATTGCCTATATACTGACCGTAACAGTAGAGTACAAGACGTATC CTAATTGGCCAGTTTATTACAATTGCGTTTAACAAAACAATTAACGCTAAAAACTTAACTGACTTGCCATATCATTTACA AAACGACATTAAAGACTCGCAAACAACAGTCAATATTTCAACAATAACAATGAATCGTAAAACAGTAGTTTACTAGAAGT TGTCTAATCATCATGAAATTCACAGTGGAATTGGACTAAGCCTAGCCACTGGGACACATATTAGAGAATTAGCCCTTCCC ATATCGATCCCTGGTGCCTCTTCCATGTCAAGCTTAGTGTCGTTTCTTCCGTTGACCTTCCATTCAAAGCACTGAATCAT TGAAGCAAGGTTTGTGTGAACGACATGAAGTGCAAGTGAGGCCCCAGGGCATCCTCTTCTCCACTCCCAAATGGAAAAAA ATGAAAGTTTTGCCCTCTCACAATATCCAACTCGCTCTTTCCATTTCCTTGTTTGCTAAGAAACCTCTCTGGCTTGAACT CTAGTGGGTCAGAAGCAACGAAAGTACTTTATCCTGGTTACACGAAGAATTCTTCTCTTACATGCATTGTCAAGTTAATA CATGTGAAGGTGATGAACAATTGGAGTAACAAGTCATTTGATAAGTTACTTCAGATACTTAGAGAAACATTTCCAGGCCG CAATAAGCTTCCAAGTTCCTACTATGAAGCTAAACGAATGTTGCGTGAACTTGGTTTGGGCTATGAAACGTACAATTCAT GTGTGCGTAAATGATTGTGCGCTATTTTAGAAACAACACAAGGACGCTGAAAAATGTCCTATTTGTAATGAACCAAGGTA CAAACCAGGTTGTACTAAAGGAAAAAAGATACCAAAGAAAAAGATGTATTATTTTTAAATTACTCCTCGTCTACAAAGAC TTTTTATGTCAAGACACACATGTGATGATATGAGATGGCACAAAAAAAACGTGTTAATACTGAAGGTGTGCTTAGACATC CTGCAGATGCTGAGGCTTAAAAAGAATTTGATAAAGAGTATCCGTGGTTTGCAGAGGACCCAAGAAATATTAGACTGGGA CTTGCAACTGATGGTTTCAACCCATTTGATAGTCTTAATATCAAATACAGTGTATGGCCTGTTATTTTAGTACCATATAA TATGCCACTTTGGAGATGTATGAAACAAATGTTTTTTATTATGGCGATATTGATTCCTGGTTCCAAAGCCCCTAGTAAAG ATATTGATGTATATTTACAACCTTTAATTTATGAGATGAAAGAATTATAGAAAAATGGGGTTAGAACGTACGATGTGTTA AATGATGAATATTTTACGATGCATGCTGCACTTTTATGGAGAATCAATGACTTTCCAGCTTATGGTACAATATCAGGGTG GAGCACAAAAGGTTATAAGGCATGTCTTGATTGTAATGAGGATGGAACATCCTTCTACATTAAGGACAAGATTAGTTATA TGGGGCATCATCTATTTACCTATGGATCATCCGTGGCGGAAAAGTAAATGTTATGATGGTAAAATTGAACGACGACCTCC TCCTAGAACATTCACAGGTGATGATATCTTAAGGCAACTGAAAAAGGTAGATGAATTTATCCTAGGAAAAAGATCGTAAA AGAAAAAGAAAAAAGAGAAGGTGATGTGCGTGGTAAGAAAAGAAAACGCGTTGTGCTTGCCAAAAAAATTATAAATAATG ATGTTCCATCAAATAATTGGAAGCCAAAATGCATTTTGTGGGAGTTAGAATACTGGTCAAAATTGAAGCTAAGACATAAT TTAGAAGTGATGCATATTGAGAAAAATATTTGTGAGAGTCTATATGGGACAGTCTTATGCATAGATGGAAAGTCGAAGGA TACTGACAAAGGTCGGATTGGCTTGGCTGAATTGAACATACGCAAAGAATTGCACTTGCAACAAAAAGGTGATAAGTTTT TTAAGCCCGTAGCATGTTACACATTATCACTAAAAGAACGAAGAAAATTTTGTGAGTGGTTAAGTTCTGTCAAGTTTCCA AATGGTTTTGCTGCAAACATTTCGAGAAATGTGAATATAAATGAGGGGAAAATATCCGGTTTAAAAAGTCATGATTGTCA CATTTTATTGCAACGTCTTATTACTACTAGGTTGAGGCCTTATATGAAAAAGGATGTGATTGTTGCAATTTCTGAACTAT TATTATTTTTTCAAAAGCTATGTGCAAGAACATTGTTACATTGTATGTTACAGACTTGGATGCCTTGCAAGATGGGATTA TCGAGTGTATGTGTAAGCTTGAATCTATTTTTTCCCTATCATTTTTTGACATAATGGTTCACCTAGCCGTACATTTACCT TATGAAGTGAAGTTGGCTGGTCCAATACACACACAGTGCACTACACCACAAAAGGCCTTTCGTAGCTGACAAAAAACGCT ATTAATCACTATCAATAGCGCTTTTTAGAGCGCTAAGACAGCGGGCACTATTATAAGTCCTAAGAAAACATAGCGTTTCA AGAGAGTTATAAAAAACATTATAAAATTGAAATATTATAGCATTTAAAACAAGCTATTTTCATCCTATTACAGCTCTTTA GCATAACTACGATACAAATTAATAACTTTTTTCCCTTGTTATGTTCATACTCTTGTAGCTTTTTAAAATTATTATTGATA TCCTTCTGAATTCATTCAAATAAATAGTAATTCCGAGATATGTGATATATCTAAATAGGAACATTCAAATTAAAACATAA AAACATTCAACATATCAATTGTTATTAGTATCTACCAAGTTGGCAATAAAATTACGTCTACAACATAATTCGTACAATGT TCAAAACCATAACATTCAAAACAAGTAAAGAAAACAGAAAAATAGCTGGAGATATCAAAGTATCCAAAACGTCTAAGTGC AATGGTGAAGTAAATCCTTCCATCTTGACAAGATGCTTCATTAAACCTGAGGCAAATGACGACTAGCTTTCGTTTCTTGT TATGGTCCAACAACGGCGACGTTATCCTGCCTTTCTCCTGCCGTGGAAGGACTTCAGCCAGCAGTCTTCACTCAATAGAA GACTAAATGACAAGACTCAAATGCCAACAAGCAACTAGTTAAGTATAGACTACTTTTGACCCTAATTACACCATCACAGA ATTAAACTCAAACAAGAGCTAACAAAGTAATAAACTGCCAACATAGCTTCAAAAAGAATACTCCTACAAGTACAAATAAA TCAATCAACTGATAATCAAATCCAGAATTCATTCCGTTTCAACTTTACCTTGGAGGAAATCATCTCGGCCGTGGCAATCT TAGAAAGCTTAGCCTTGAAAGAAGGATCAAGATCCTTCTTGTCCAACGCCCGAACTCCAAATGCCATTACTTGAAAAACA CCAGCCATGTTCCCGAAGCGCTAAAAAAATCAAAAATGGAGGAAAAAAAGAAAAAAGAATCCATACAAGATCCATTTTGG CGAGGATATTGACATGGGGCAGCTCAAGCTGGACCATTGCAGAAAGAGATGCCATGCATCTACTGATAAACTTAGTG