>DTC_5_1_Mno length=7413;Class=DNA transposons;Order=TIR;superfamily=CMC; CACTACAACAAAAAGGGTTATTAGCGATGATATTATTAGCGACGACATTTGTCGTTGCTAATAGTAGGTTATTTGCGATG ACATGAAATAAAATTTTTGAACGATGTTTCGTCGCATTTAATATTTGCGAGCACGTGTTATCACGTATATGTTAATATTT GTAATAACATGTTGTCGCTAGAGAAAAGAACAATATTTGCGACGAAATGTCATCGCCAATATTTATTAGCGCAAAAACTA ATCTGGCGTTAAAATATTTGGTGCCAGTTTGTCCATTAATTGTGATGACATGTCGTCGCTAATATTCAGGTTGACAACTG GCAATGACGTGGCCAAAAAAGGCATAAAATTTGGTGGTTTCTCAAAAATAAGTTCCGTAAAATTCTTCATTTTTTGCGAC GACATTTACGAACGGTCGTCACAAATAGTAGTTCCATAAAATTTTATCATTCACGACTACTTTTGCCACGACATGGATCA ATTGTCGTCGTAAATATTGGTCGAACTTAATTTGTCATGAAAAAAGGCAAACAATTTTGGCAGTTCCCAAAAAATATTTA CAACGACGACTTTTTAATAAAGTCGTCACAAAAAATAAGTATGGGTATATTCCCCAAGACTATGCTCAGAAATATTAATG AGGGGCAGAAGAACAACGTCATTTTAGAATTAATTGCGATGACTATTTAATATTTTTTGCAACGGCAGATTGTTGTCACA AAAAACCACCTGTATAAACGCAATCGCAGAACTTTTTTCTCTATTTTTTTCAGGGAGCTCTCGGTTTTCCCCCTCCATCT CCATCGAAAACTGCTACAAACCATCCAAAAACTCTTAAAAAAGCTTAAATCTAGCATTATCTCTTCAAATCTTTCATTTG TGGAGAAAAATATTTTGAAAATGTTCAAAAACAGCAGTATTGGAACCTTGCCATCGCTGCCTGCTTTCCCATCATTTTTC GGCCGCCTTCACCCTCTCAGCCATGCTGCCTTTCTATTTTCCAACCCCCGGTGTTTGTGGGTTTGGATTTTGTGTTTAAT ATTTTGGTATTTTATAAATTGATTTTTTTATTTTGTTTGTGGTTTGTGGTTTTGTTTTGGATTTTGTGGTTTTGGATGTA TTTAGATGTTGTTAGTAGATTGTTAATGTGATAAATTGGAATTATAATTGTGAATGTGGTAGAATTAGAATTGAATAGGG TAGAATTAGAATGAAATAAGGTAGAATTGTGAATTATTAGAATTAAAATTAGAATTTGTGGTAATTAGATTGAAATTTGT ATGATAATTTTGATGTGATGATGATTATGTTCTTGGTAAAAAAGAATTTAGATGGAAATGTTAAAAAGTTAAAAAAAAAG TAAAAAATATGTTAGAAAATTTTAATTAATGAAAAAAAGTTGTAATTATTATTATATTAATAATAAAAAATTTTAAAAAT AACTATTATAAAATAGTTAATAGAATGTTAAAGACTTATTACAAAATAATTTGTGTTAATTTTCATAAAATTTGATAAAA CTTCATAAATTTTTCGTAGTGGAGATACCTATGGACAATAGTTGGATATATTTAAGGAATCGGTTGTCTGATGAGTACTG AGATGGTTTGTATGCTTTTATTGAGGTTGGAAATAATTATGCAAATTCAACTGGGGGTATTAGTTGTCCGTGTATCAAGT GTAGAAATCATGAGATGCTGCCATCTGAAATAGTTAAAGCGCAGATACATCGATGGGGTTTTGATACAAGTTACACCACA TGGATTCACCATGGTGAAGTACGTGCTGCTACAGTTGTCAGTGAACCGGTTGACGAGATGTTTACAGTGCTAAATGATGT GGCTGGGATTAATGATGATCATGAAACCTTGGTACACAGAAGCGGTTATAGAAGATATGCATTACGATGAATTTAGGGAT ATCTTATCCGAGCTCTAAGTCAGATTATATCCGGGCTGCCATAAGTATTCATCGCTGAATTTCTTAGTGAAACTAATGCA TCAAAGGTGTTGCACAAGTGGCCTAATAAGTGTATGGATGAAATGTTGAAGCTACTGAGAGATGCACGCCCTGAAGGGAA CAAGTTACCTACATCGCATTACGAGATGGAGAAGTTATTGAGTAAATTAGGTCTGAGCTACGAGGTAATTCATGTGTGTA AGTATGATTGCGCTTTGTTTTGGAAGCAGAATGCTACTTTGCAGTCTTGTCCAGTATGTAGTATAAGTCGTTGGAAGAGT AAAAAGGGGAAACAAGTTCCGTGGAAAGTACTCTGATATTTCCCATTGAATGATCGGTTGAAGCATCTGTAAGCTTCTCG TCACATTGCTACGGAAAAGACGTGGCACGTGCGTCAGCATTTAAAGGATGACGACTTATTGTGGCATCCAGTTGATGGAA CAGAGTGGAAAGATTTTGATGAAAAGCATCCACAATTTGCACATGAACTAAGAAATGTTCGATTAGGGTAAGCTGCTGAT GGTTTAAACCCATTCAAGAATATGAGTCTATCATACAGTATGTGGCATGTGATTGTGATTGCATATAATTTACCCCGTGG CTATGTACCAAGGACCCATACAAGATGTTGACATTATTGATTCATGGTCGCAATGTTCCTGGGAAGGATATTGATGTGTT CTTAAGGCCTCTTCTAGATGAGTTAAAAGAGTTATGGGATGAATGAGTTGTTTTCGTGATGATGCTACGAATACGTCATT CCGGATGCGGGCTGTGTTGCTGATGACAGTTAACGACTTTCTTGAACGTTGTAGTTTATCTGGTTGGAGTGGTCAAGGGT GCTTCGTGTGTCCTAATTGCAACAATGCAACTCCATCAAAGCGAATATCGAGTAAAATTTACTATGTTGGGCATAGACAA TGGCTTCCTATGAGTTATAGGATAAGGACTAATAAAAAGTTTGATGGTAAGGTTGATCGACGACCTCCCCCCCCTCGAAA ATCCATTAAGCAAATATTAGCTCAATTAGAAAAGTTTGAATCTAGATTGCCAAGTAAACATGAAAGATATGGCAGTAAGA AGCGAAAGAGACATCCGACAGAGCTTAATTGGATGAAGAAGAGTATCTTTTGGGAATTGCCTTACTGGACCTCATTGTCG CTACGTCATAACTTTGATGTCATGCATATTGAGAAGAATATGTGTGACAGTTTGTTGGGAATAATTCTAAATATTGACAG AAAAAGTAAGGATATGGATAAGGCGATGATCAATTTACAAGATATGGGGGTACGTAATGAGTTGCACTTGTATAAAGAAG GTGATCATTGGATGAAACCATATGTAGCGTACACATTGACTCCGGATGATTACAAAAAGTTTTGCGATTTCTTACAATCC ATACAGTTTCTTGATGGGTTTGCTTTAAATCTTCAGAAAAACGTGATCGATGGAAACAATAAGTTTACTGGTTTAAAATC ACACGATTGTCATGTCATACTGCAGCGATTGTTGCCAACCAAATTGAGCAACTTCTTTCAATTGATATGTTCCAGGACAT TGCGGATTAGTGATTTAGAGAGAGCCTAACAGGATATTGTTGTTATTTTATGCAAGTTACAAATAATTTTTCCTCCAGCC TTTTTTGATGTAATGGTTCATTTAGTAGTGCACTTGCCAGAAGAAACCATTCGAGGATGACCTATTCATTTAAGGTGGAT TTATCCTTTCGAACGATTCCTTGGTTTATTAAAAAAATATGTTAGGAATTGTGCAAGACTGTAGGGATCGATTGTCGAGG CTTATATTGTCAATAAAGCACTGGCTTTTTGTTCAATGTATCTAAGTGGCATTGAGACAAGATTTAATATACTTGAGAGA AATTGGGTAGAGGACGAAGATGGTAATGTGAAGAAAATATCTGTCTTCCAAACTCGATATCGTCCAATTGGAAAGATGAT CCTGATCACACTAGACAACCAGGCACAAAGTATCGCCGAGTGATACATATTACACAACTATTCAGAAATCCAACAATGCA TTGAGTAAGTATTACCCCACCATTTTATTACGTAATTGTGTCACATGAAATGATAACGCTAACTCAAACTTATAATTTCA GTGAGCATAAGAAAGAACTCAATGCTACTGGTCAAACCAGATCATTAGATGAAATTAAAGTCAGGGAATTTCTAAAATGA TTCTATAGTAAGGTACTATACTATAGTCATAATTTATAATTTTGAATACTCTTGCTATATATAATTTTAATTGATATTGT TTACTATTGACAGATGTCAAATTTGCAAAAGCAGAACGCGCCAGAGACGATCGCACAATTGATTTCACTTTCGTGTGGTT CAAGCTTTTCCATTAGAAGCTACTCCAGCTGTGTGGTGAACAGAGTCAAGTTCCTGACATACAGTTAGGATATAAATCAA AATACCCATAATATTGGTATTTGTGTTCATGTACTAGATAATCAGACATATTACGGAGTACTGGAAGAGATTTATCAATT ATCTTACATAAACGACAATTTTGTTCTTCTATTTAAATGTAAGTGGTTCGACACTCATCCAGAAAGAAAGAGAGTTCAAC AACACAAGAATAGAACGAGCATCTTTGTTAAGGACTCTAGGTATGAGCACGAACCATTTATACTTACATCTCAAGCAGAA CAAATTATTTATGTGGATGATTTATTCAACGGTTTGAACTGGAAAGTTGTTGAACATTTTGGACATCGACATATATGGGA TATTCCAGACGCAGATGCAGACGACATCACAGTAGTTCAAGATACCGAGTCTATGAATGTTGACTTAGTCGTGGAACTCC TAGAGATTGACACTTTGATATGGAATCGATTAACACTTTGATATGCAATCGATTAACACTTTGATGTGAAATTGACCTGA TACATCTGATGTTGCCATGTCCAATGTTGATGCAATTTTGAAAGACAAGTCTCCTATTAAAGATAATGACTCCGATATAC TGGTAGAGAATGATGAAGTCTTAGGAGACTACGTTGAAGAAGACATGGACGATTATGAGGATTATAACGACATAAATGAG TGGGGCGACATTCAAGACATTAGCAGTGACGATGAATAGAAATTATGTACTGTGATTATTATTTTAATAATTATATTTAT TTACATAACATAAGAATTATGTGAATAAGATAATAACGTTTATGATGACTTGTTAACAGGCATTCATGTCTAGCCCAGTC GCTACAAGTGTTGGCTCTTTAGGGGGAGCGCAGCCTCCACCCAATCCTTATAGATTGCCATCACACTGTGAGTGTGAGTC TGGTATGTTAGAACATAATTATAAATTTGTTAAATTCATTACATTAATATTATATGATCACTTAATGGTATAGTGATTTA ATTTAAATTTCATTTTACATCACCAGATGCCGCACCTCGACAACGTCGTGGAGGTCGAGGGAAACCTAAGGGTCACGAAA TCACAGCTAAAGTGGCGAATGATTGAAAGATCACCCCCACATTTGATGAACGTGGAGGTACTTGGAAGGCAATAGGAAAC TACGGCACTTGGTTCGATGGTGTCGTAGGAATCCATGTTAGGGATGTCTGTGAGCCTTTCCACGATGCCTAGAAGGACGT GGACATCCAGCATAAGAGAGAGATTCAGCAGCGCCTATTAATATAAATTATTCAACTTCATTGTTTTTTTAATTTAATCC AAGTTTCAATTCATAAAATCACTTAACATGTTTTATTGTATTACAAAAATGGTTTAACCTCGATTATGACCGCAATGAAG GTATCATTAGGTTTGTGGTCGACAGGGAGGCTGTAAAATGTTATAAGGATTGGAAAAGTGACCTCCATGACTATTTTAAA GATCTTAGTGGGCCGGAAAATGATAGTGTTNNNNNNNCCCCCCCCCCCCCCCCCCCCCCAAAAAAAAACCTCAAGAATCC AGTAAAAAGCCTCAAGAATCTAGATCACTGGGGTCGTTGTTGCGATAGATTCATGTTCGACAAGTTTCAGGTAACTGTAA ATCTTTTATATGTTGTTGTTTTATTATATATAAAAAATATTAATTTTACTAACTTTGAATTTAATCATAAATAGAAAAAG TCAGGTATCAATAAACTTAATCGTAGCAACCAAAAGTGGTCGAGCTTTCATGGTCGGCTATCGTACTCCCAATATCGCGA GAAAAAAGTTAGTATTTGTTAATAATTTATTCAATATAAATGTTGATTTCATAATTGATTACAATATATTCATATACATT TACATTATTATACAATCAAACATAGGGACCCAACAGCCGATGTCTGCCATCGATAACTAGGGGAACATGCATCGTCATAG GGATACTTGGGTTAATCCCCAAGCTAAGCAGACTTTTATAAGTAAACTCGTAATGCTTAATTATATTTTTTTATTTAAAT TAGATTATGTATTTAATTCTTTTTCTTATAATATTTGTAGCATCGGATAAAGGGAGAAAGGAAAACGAAGATCCAGACGC AGTCTGCTACTTCTGGATCATCCGCAACAAAAGCGATTAATGAGGATGGTATTATGGAGCAGGTTCTCAGAACTCGCAGA GGACACAAGACTGGAGTGGGTCGCACACTCTCACAAAGGGTTTATCGAGGGGATGCGTCATCATCTGACTCACACTCGAC ATGATCGTCTACGCCACGTTTGGACCCACACATAGAAGAATACTTGCAACAGAGTTACTGGCAAAACCTCCAGATGTACG GGAGCTTTAGAATGATGCAGGACTTGATGACTCAAATGCACCCCAACATTCAGTTCCCATCGGTTACTCCTCTCGTGCCA TATGTCTGTCCAAGTCCTCATCCGAATCCTTTCGATGATAATGACAATGATTCCAGTGACGCTACTAACTTAGGAGAGTA GATTTTTATTAATGTAATAATTTATACTTTCTTACATTTTATAATTACATTTTTATTTTATTTTATTAATACTCACACAA TTTAATTTTATTTATATTTTTCTATTAATTATATTTCTTTTAATTAAGTCTTTTTTAGTTTTATAATATCATGAATTATG TTTAATATTGGGTTTAAATATATAGTAATATACAACATTAATCATTAAAATGAGAAAAAATAAATAAAAAATTAAAATAC TATTTGCGACGACAACTGTGGTCGCAAAAAATTTAATGCCACGTCGGCTAATTCTCCATTATTTGCGATGACATAATTTG TGAATTATCGTCGCAAATAATAATTGCCATGTCATCTTGACGATGCAATCGATGAAATAATTGCAGCAACTCATTTGCGA CGACGACATGTCGTCCAAAAAATAATTTTGCGGCAAATCAATTGCAGCGATATGTTTGCAACAATGAGTCGTCGTAAAAA TATATATTTGCGACGACTTTTAGTCATCGTTAATAACCATGTTTCTTATAGTG >DTC_5_2_Mno length=2771;Class=DNA transposons;Order=TIR;superfamily=CMC; TAGAATTGTGAATATGGTAGATTATAAATTAGAATTGAAATTGGAATTTGTGGTAATTAGATTGAAATTTGTATGATAAT TTTGATGTGATGATGATTATGTTGTTGGTAAAAAAAATTTAGATAAAAATGTTAAGAAGTTAAAAAAAAGTAAAAAAAAA AAATAGTGATATGTTTAATAATTAAATGATAAATAATAAAAAATAAATGAAGTTGAAAATTAAATGTAAAAAATGTAAAT AAAGTAATTATTTATTATATTATAACAATTTGAGAAAATGTTATAAATGAAAGAAAAAATAGGTTAACAAGTTTAATTAA TGAAAAAAGTTTTAATTATTATTATATTAATAATAAAGAATTAGAAATAATTATTATAAAATAGTTAATTGAATGTTAAA GACTTATTACAAAATAATTTGTGTTAATTTTCATAAAATTTGATAAAACATCATAAATTCTTTGTAGTTAAGATGCCTAT GGAGAAAAGTTGGATATATTTAAGGAACCGGTTGTCTGATGAGTATTGAGATGGTTTGTGTGCTTTTACTGAGGTTAGAA AGAATTATGCAAATTCAACCGGGGGTATTAGTTGTCCGTATATCAAGTGTAGAAATCATAAGATGCTGCCACCAGAAACA ATGAAAGCACACATACATCGATGGGGTTTTGATACAAGTTACACTATATGGATTCACCATGGTGAAGTACGTGCTGCTAG AGTTGTTAGTGAACCGGTTGACGAGATGTTTACAGTGCTAAATGATGTGGTTGGGATTAATGATGATCATGAAACCTTGG GTGAGGCAGAAGTGGCTATAGAAGATACGCATTATGATGAATTTGGGGATCTCTTATCTAAGCTCTAAGTCGAATTGTAT TCAAGCTGCACTAAGTATTCATCGTTGAATTTCTTAGTGAAACTAATGCATTTAAAGGTGTTGTACAAGTGACCTAATGA GTGCATGGATGAAATGTTAAAGTTACTGAAAGATGCACTCCCTAAAGGGAACAAGTTACCTACATCGCATTACGAGGCGA AGAAGTTATTGAGTAAACTGGGTATGAATTACGAGGCAATTCATTTGTGTAAGTATGATTGCTCTTTGTTTTGGAAGCAG AATGCTGCTTTGCAGTCTCGTTCCGTATGTAGTACAAGTCGTTGGAAGAGTAAAAAAGGGAAAAAAATTTCGTGGAAAGT ACTCCGATATTTCCCTTTGAAGGATTGGTTGAAGCATATGTATGCTTCCCGTCACATTACTAAGGAAATGACGTGGCACA TGTGCTAGCGATCGAAGGATGACGACTTAATGCGTCATCCAGTTGATGGTATGAAGTGGAAAGAGTTTGATGAAAAATAT CAACAATTTGTACGTGAATCGAGAAATGTTTGATTATGGTTAGTTGCTGATGGTTTCAATCCATTCAGAAATGTGAGTCT ATCATATAGTATATGGCCTATGATTGTGACTGCATGTAATTTACCCCCATGGCTATGTACCAAGGACCCGTACAAGATGT TAACATTATTGATTTCTGGTCTTAATGCTCCTAGAAAGGATATTGATGTGTTCTTAAGGCTCTTTGTGGATGAGTTAAAA TAGTTGTGGGATGATGGGGTTTTTGTTCGTGATGCTGCTACGAATACGCCGTTTCAAATGTGGGATATGTTGCAGATGAC ATCTAACGACTTTCCTGCACGTAGTAGTTTATCTAGTTGGAGTGGTCAAGGGTACTTCGCGTGTCCCAATTGCAACGATG CAACTCCATCGAAGCGAATAACGAGTAAAATTTACTTTTTTAGGCATAGACAATGGCTTCTTATGAGCCACAGGATGAGG ACTAACAAAAAATTTGATGGTAGGATTGATCGACGGCCTCCCCCGCCTCGGAAATTCGTTAAGCAAATATTGGCTCAATT AGAAAAGTTTGAATCCAGATTGTTAGGTAAACACGAAAGATATGGTAGTAAGAAGCAAAAGAGACATCCGACAGAGCTTA ATTAGACAAAGAAGAGTATCTTTTAGGAATTGCCTTACTAGACCTCATTGTCACTACGTCATAACTTAGATGTCATGCAT ATTGAGAAGAATGTGTGTGATAGTTTGTTGGGCACAATTCTAAATATTGACATAAAAAGTAAGGATACAGATAAGGCAAT GATCGATTTACAAAATATGGGGATATGTAAAGAGTTGCACTTGTACAAAGAAGGTGATCGTTGGATGAAACCACATGCAA CGTACACATTGAATATAAATGTTAATTTGATAATCGATTACACTATATTCATATACATTCAAATTATTATACAAACCAAC ACAACAGCCGATGTCTGCCATCGATAACTTGGGAGAGATGCATCATCATGGGGTTACTTGTGTTAATCCCCAAGCTGAAC AGACTTTTGTAAGTAAACTCGTAATGCTTAATTATATTTTTTTTATTTAAATTAGACTATGTATTTAATTATTTTTCTTA TAATATTTATAGCATCAGATGGAGGGGGAAAGGGAAACGCAGATCTAGACGCAATCTACTACTTCTGAATCATCCGCAGT AGAAGCAATTAACAAGGAAGGTATTATGGAGCAAGTTCTTGAAATTTGTAGAGGACACAACACTAGAGTGGGTCGCACAC TCCTGCAAAGGGTTTATTGAGGGGATGCTTCGAATCTGGCTCAAGCTCGGCAGGAAATTTTACGACACATACAGACCCAC ACGTAGAAGAATACTTGCAACTGAGTTACCAATAAAACTTCTAAATGTACG >DTC_5_3_Mno length=2744;Class=DNA transposons;Order=TIR;superfamily=CMC; AAAGCCACCGGTATAAACGCGATCGCAGAACTCTTTCCTCCATTCTTTCCGGTGACCCTTTCAGTTTTCTCCCACCCTCT CCATCCAAAACCTCTATAAACTGTCCCAAAACTCTGAAAAAAACTTAGATCTATCATTCTCTCTTCAAATATTTGATTTG TGGAGAAAAATTCTTTGAGAAAGTCCAAAAATAGCAGTGTCTTTACCTCGCCGTCGCCGCCAGTTTTTTCGGCCATCATT CTCTTTTTCTGGCTGCCGTCGTTCTCATTTTTCGGCTGCCGTTGCCTTCCCAGCCCTGCTGCCTTGCCATTTTCCAACCC TCGGTGTTTGTGGGTTTGGATTTTGTAAGTTAATATTTTTGGTATTTTGTAAATTGATTTTTTTTTATTTTTGTTGTGCT TTTGGTTTTGTTTTGGATTTTGAATTTGGTTTTTGGTTTTGGATGTATTTAGATGTTGTTGGTAGATTGTGAATATGGTA AATTATAATTATAATTGAATGGGGTAAAATGGCGTCAAATGAGTATTAGGATGGTTTGTGTGCTTTAATTGAGGTTGGAA AGAATTATGCAAATTCAACTGGGGGTATTAGTTGTCCATGTATCAAGTGTAGAAATCATGAGATGCTGCCACCAGAAACA ATGAAAGCGCAAATACATCGATAGGATGTTGATACAAGTTATACCACATGGATTCACCATGGTGAAGTATGTGCTGCTAC AGTTGTCCTTGAACCGGTTGACAAGATGTTTGGAGTGCTAAATGATGTGGCTGGGATTAATAATGATCATTATACCTTGG GTGGGACAGAAGCATTTATAGAAGATACGTATTACGATGAATTTCGGGATCTCTTATACGAACTCCAAGTCGGATTGTAT CCGAGCTGTACTAAGTATTCATCTTTGAATTTCTTAGTGAAATTAATACATCTAAAGGTGTTGTATAAGTGGCCTAATGA GTGCATGGATGAAACGTTGAAGCTACTGAGGGATGCACTCCCTGAATGGAACAAGTTACCTACATCGCATTACAAGGTGA AGAAGTTATTGAATAAACTAGGTCTGAGCTATGAGGCAATTCATGTTTGTAAGTATGATTGTGCTTTGTTTTGGAAGCAT AATGATGCTTTGTAGTCTTGTCTAGTATGTAGTGCAGGTCATTGGAAGAGTAAAAAGGGGAAAAACTTTTCGTGGAATGT ACTATGATATTTCATTTTGAAGGATCGGTTGAAGTGTCTGTACATGCTTCCTGACACACTGTTAAGGAAATGACGTGGCA TGTATGTGGGTGATTGAAGGATGATGAGATAATGCATTATCTAGTTGACGGTACCTAGTGGAAAGAGTTTGATGAAAAGC ATCCACAATTTGCACATGAACTGAGAAATGTTTGATTAGGGTTAGCTGCTGATGGTTTCAACCCATTTGGGAATATGAGT TTATCATACAGTATATGGCCTATGATTATGACTGCATATAATTTACCCCCGTGGCTATATACCGAAGACCCGTACAAGAT GTTGACATTATTGATTCCTGGTCTTAATGCACCTGGGAAAATATTGATGTGTTCTGAAGGCCCCTTGTGGATAAGTTAAA AGAGTTGTGAGATGAAGGGGTTGTTGTTCATGATGCTGCTACGAATACACGTTTCAGATGCGGGCTGTGTTGATGATGAC ACTTATCGACTTTCCTGCATGTAGTAGTTTATCTGGTTGGAGTGGTCAAGGGTACATCACATGTCATAATTAAACGATGT AACTCCATCGAATGGAATAACATGTAAAATTTGCGTTGTTGGGCATAGACAGCGGCTTCCTTCGAGTCATAGGATGAGGA CTGACAAAAACTTTGATGGTATGGTTGATTGACGACCTCCCCCACCTTAGAAATCCATTAAGCAAATATTGGCTCAATTA GAGAAGGTTGAATCTAGATTGCCAGGTAAACATGAAAAATATGGCGCTAAAAAGCGAAAGAGGCATCCGACACAGCTTTA TTGGACGAAGAAGAGTATCTTTTGGTAATTGCCTTGCTAGACCTCATTGTCGCTATGTTATAACTTAGATGTCATGCATA TTGAGAAGAATGTGTGTGACAGTTTATTGGGCACAATTCTAAATATTGACGGAAAAAGTAAGGATACAGATAAGGTAAGG ATAAATTTATAAATTATGGGGGTAGGTAAGGAGTTGCGCTTGTACAAAGAAGGTGATCGTTTGATGAAACCACATGCAGC GGATACATTGATCCCGGACTGTTGTAAAAAGTTTAGAGAGAGCCCAACAGGATATTGTTGTTATTTTATGCAAGTTAGAG ACAATTTTTCCTCCAACCTTTTTTGATGTTATCGTTCATTTAGTAATGCACTTGCCAGAAAAAGCCATTCGAGAAGGACC TGATCATTTAAGGTGGATGTATCCTTTCAAACAATTCCATGGTTCATTAAAAAAATATGTTAGGAATCGTGCAAGACCGG AGGGTTCGATTGCCGAAGCTTATATTGTTAATGAAGCACTAACATTTTGTTTTATGTATCTAAGTGGCATTGAGACGAGA TTAAACATACTTGAGAGAAATTGAGCAGACGACGACGATGGTAATGTGAAGAAAATATGTATCTTCCAAACTCAATACCA TCCAGTTAGGAAGATAATCCTGATCACATTAGACAACCAGTTACGACATAAGGCTGAGTGGTACATATTACACAACTGTT CGGGAATCCAACAATACATCGAGT