>DTC_20_1_Mno length=2688;Class=DNA transposons;Order=TIR;superfamily=CMC; ACCCCAAATAGGCCCCTTCTTCCTTCTGTCTGCCGCCATTCTCCTTCTGTTTGCCGCCTTTTCTCCATAAATCCAAGAAG GACTACAAATCCGTGAAGAACATGAAGAAAATTTCATTAATTTTCTCATTTTTTGTATAAATTTGATAAAAAATGAAGAA AATAGCTTAGATTTTATGAGTTTGAGTATTATAGATGTTGGGTGTTTGTTGTTTGATAAAATTTGTTTATGTTGATGATG AAATTAGTTTAGATTTTGTAATTTTGTGTAATATGGGTGTTGGCTTTTTAGTTTTTGTCTTGAATTTGTTATGTAGATGA TGAACTTTATTTAGGTTTTGTGGTTTTGAGTAATATGAGTGTTGAGTTTTTGTTGTTTGTCTTGAATTTGTTATGTAGAT AATGAATTTTGTTTATGTTTTATGATTTTGAGTAATATGTGTTTGGGTGAGTGAGATATTTATTGTTTAGTTTTTTGTGT AGCAATGGTTAGGAAATGGATGTTTGCAAATAGGTTGAGTAATGAATATAAGGAAGGGGTTAAAGAATTTATTTCTTTTG TAAAGAATACAATCAAAGAGAATATTATTCATTGTCTGTGTGTGCAATGTGGCGATATTAGAAGACAATCGATGCAAGAT CTTAGATTCCATTTGTTCCGATACGGCATTGATAAGACTTATCAAACATGAATATGACACGGTGAAAAGGTTCTAAGTTC ATCTTCGGCGATTAGGGGGATTGAGAGGAATGACGTTGATGTTAATCATGAAGATGGTGGAAGTAACATGGTTGATATGA TTAATGATATGGAAGAATAATTTGTGCACCGACCATAGTTATTTGAGAAGATGATAGACGATGCGGAGACACCATAGTAT AGTGGGTGTAAGAACTATACTAAATTGTCCAGATTAATTAGATTATGGAACTTGAAGGTGTCGGGTAAGTGGTCAAATGC AAGTTTCACAGGACTCTTAGAATTTCTAAAAAATGCACTTCCAGATAATAATCAAGTGTTAGGTTCTATGCATGAGGCTA AGAAGACGTTGAGCTCTATGGGGATGGGATATGAGAACATACATGTGCGATCAAATGATTGTGTGCTATATCGGAGAGAA TGTGAAGATTTGGATGAGTGTCTGGTGTGCCATGAGTCTAGGTAGAAGGAAGGTAAGAAACTGTCCAACAGGAGAAAAGG TGTGCCAGTGAAGGTGTTATGGGACATTCCGATCGAACCAAGATTAAAGCGATTATATCGAAATCCAAAGCATGCTAAAA ATTTAACTTGGCATCATGATAAGATGGCCAACGATGGTATGCTAATAGTGGAAGATATTTGATGCAGAGAATCCTGAATT TAGTGCGAAACCTAGAAATTTGCCTTGCATTGTCACCTGATGGAATGAATTTGCATAGCAATTTTAGCAGCAAAAACAGT ACTTGTCTCGTCATCCTTGTAAACTACAATCTTCTGCCAGACTTGTGTATGAAGTAAAATTTTCTAATGTTAACCTTGTT AATTTCTGGACCTAATCAACCGGGAATTGATATTTATGTCTAGTTGGCACCGGTGATTGACGAGTTGAGGAGATTGTGGG ATAGTACAATCATTTCCGCGATGAGTCCTTTGTACCCCAAGCAATGTTGATGTGGACCATTAACAACTTCCCTGCATATG GAAACCTATTTAGGTCTTGGTTAAGAGTTCCATATGTTGCCCTATTTGCATAATAAAGACATGTTCAATCCGGATGAAAC ATCAAAAGAAGATGATGTACGATGGCCATAGGAGATTCATGCATATGAATCATCGATACCGCAAACAACGAAAAGCTATT ATTGGTAAAATAGAAGAAAGACCACCTCCAAGACCTTCGATAGGTAAACAAGTGTTTGATATGGTTAAAAAAAAAAACGT AAAAGTGGTCTCCGGGAAGAAGAAATGAACAAATAATGAGCTGGTGATCAGACCTTGGAAGTAAAAGTCGATTTTCTTCG ATCTTCCATATTGGAGTTCATTGTTAATTCGCCACTGCTTGGATGTTATGCACATTGAGAAGAATGTTTGTGAGTCGATA GTTGACACGCTACTTGACATCCTTGGTTGAAACTAAAGACGGCCTCAATGCACGGTTGGATCTCATGGAATTTAACATTA GAGGTGACTTGGCTCCTGAGAAAAGAGGCTCCCGCACTTACTTACCTCCGCTAAGTGCACATTATCGAGACAAGAGAAGA AGAAATTCTGTGAATGGCTTGCTTATGTCAAAGTTCCAGAAAGGCATTCATCTAACTTTAAGAACTTGGTGTTGGTGAAA GAATTAAAGATGACCACACGAAGACACATGATTGTCATACTTTGATGCAACAACTGTTGCCACTTGCTTTGCGTGGGATT CAAACAAAGGAGGTTAGATTTTCACTTAAGAAGTTTTGCTACTTCTTCAACTCCATATATTCCAAGGTAGTAGATCTAAT GACGTTGGATACACTACAATAATAGTTAGTGATGACCTTGTGCATGCTAGAGAAATATTTTTCACCATCATTTTTCGACA TCATGATTCATCTAACGGTTCATTTAATCAGTGAAGTTAGGCTTTGTCAGCCAGTGTACTTGAGGTGGATGTACCTTTTT GAAAGGTACATAAAGATTATGAAAGGTTATGTTAATAATCGAAATAGG