>DTC_2_1_Mno length=11828;Class=DNA transposons;Order=TIR;superfamily=CMC; CACTAAACACGTTAAAAATTATCGAACCTTAAGGAAGAGACCATCAGTTTTCTGCATAATATTTGCTTTGTGTATTGCAG ACACTCTCTCTCTCCCATGCATCTTGGCATAGTGGAAAGCATACTCAGCAACCCTTAGACTCGCCTGGCGAGTAATGATC TTGAGACTTTCCACAACACCTCTCACCACCTACCAACACAATAAGGAGCTTTCTCAAACTGCTATTCAAACTGATATACC ACAATCATCAATACATTATGCAAAATACATTCTTTAAAATTAAATTTAATTAAAAATAAAACTTACTTGATGTTCAAGTC CACTGTACTCTCCCTCCGTGTTCTCACGGATAGTGATGAGATTGACATCATCATAACGTGTCTTATAACCAGGGAGGCTA TAGCAAGGCCTAACATTGGCGTACAAATTAAGCTCTTTCCTCAACGTAAGGTTCAAAGAACGATGCCCTTTCCCAATTGG AGTGGCCATCGGTCCTTTCAGTCCCACCTTGTTTACCCTCACCGATTCCAAGCTATCCCATGTCAGAAAACTCTGGGTTC TAGGATCAATTTGGTCTCCTACATAGTGTTCTTCCCATTCAATCGGCACTTCAGCTTCTCTAAACACCTGAATCACTAAA AATTCGTTTAATTAATCACAACATGAAAAGAAACTCACCATTTCACTTTTTGATCGTTGCAAATTCAATCTCTATACGCT AATTAGCCGAAGATACTAACACAATCCACTAAAATCGAGCCAAAAAACTTAAAAACATAATTCAAATCAGTCCAAATACC GTTAAAGTCGTTAAATTTCATCGCCACACGACAAGAAACCCCCTATTAAATTAAACAATCCAAATATCCTCACTTCTCTA ATTGATCGTCGCAATATCAGTCTATATACTCGAATTGGCGTAAGAATCTAAAACAATCCACAAGATCCCTAGCGACAAAA CCTTTAAGTTCAACCAAAATTTCCCAAACCTAATTACTCGAACTAATCCGGGATTTTTCAGCGGCAACCGAGTGTGATAG TCGAAAACTCAAACGCGCATAGGGAAAAACATTTCTCGAAGAAGAAGACGAAAAAGAACGAGAAATATAGGTGAGAGAAA GGGAAGGACCTGTTTGACGGACTCGGCGATCTCGGGGCCGATACCGTCGCCGGGGAAGAGGGTGGCGCGGATCAGATCGG CGGCGGAGGAGGAGAAAGCCCTGGCGGTGGCGGTCGCCGGCGAGGAGAGGGAGGAGCTAGGGTTTGCGGAAGAGATGATC TGGCTCGAGCGGCTTCCGAGGGCTCGTCTCAGCAGCTGCGAAGCCATGCCCATGATTTGCCTCTTTTACGCGAAGATGAG AATAAAAAACAAAAAAATCAGAGTAAAATGTATTTATACCCGGGAATGTTGACCCAAGTGCTTCTAATTTTTTATGCCTT TAACGCGCAAGTGAGAATAAGTGGGATTTTAATTAGCTCTATTACTATCTCAATTGTATCACTTTAGTCTCTAAATTTTT AATTTTAATAAATTAAGCTCTAAATTTTTAGTTTTAACCATTTTAGTTCCTACACAATACACACTAAAATTGACAATTAA CTTATTTAATTTCTCGAAGATAATCATGTCTGGGAGAAAAAGTAATTGAAATTTTCAAAAACACTAATATCAAATGCAAA ATGAACTAGTTTTTAATGGTTTATAATAATAATATAGGTATTATTAATATTTAATGTAATTATTTCTGTAAAAGTTTCAG TTATTATAGATTTAAAATGTGATGATCTCTATAAAATTTCATAAATTCATCGCTAATTTTAGTGTGCAGGGATTAAAGTG GTTAAAATTAAAATTTAAAGAGCAATTTGTTAATATTAAAAATTTAGAGACTAAAAAGATAAAATGCACATAATTCAAGG ACTAACCGTCTTAAAAACTAAAAAAAAAAGGTGGGATTTTTATTTTTGTTTATTTTTGCTAATGGAACATTTGTTCCCTA TGCTTTATTTTAATTTTTTTAGGTGTTCTATCCTTTATTTAAGTTGGGTTCTAGATTGGGCCTTTAGATTTGGTTCTAAA TGGAGGCCTGCTTAATCGTATGTGGCTTTATACGGCCCAACATTTTTACAATAGTTTGTTCCGAAGTCAATCCCAAAAGT CCAGCCCAACACATGGAACAAAGTGGGAACGCGGGTGAATTCAACCGAAGTCTAGTCAATAGTCATTTGTAGCTTAATGC ACGATTGATGAACTGTAAAACCTTTTGGAGTTTCGATAATGAAGTCCAATAAATTTTGCCAAATAGAAGGGAATTACTTT TTTTTTTTTTTTACTATGGCAAGGGGCAAAAAAAAAAAAAAAAAGAAGGATTTTACCCCAAAAAAGGGCAAAAACTCATC ATGGATGGGCTTGAAATTGATAAGTATAATCGAAAAACACCACCAAATTACCGAGTTAATTTTCATTTTTTTGTAATCAT GCAAGTTTACTGATATTTTCATTAATGCCAATATGCCTATACTTTTAACTTTAATATCTATGTGATTCCCGTTTCTTCTC CTTGAGAAGATGTCTCCGGTCCAGTACCAGTCCAGTATATTTAACATTTTTTATTCTTCATTTTAATATCTTTTATTATA CTATTTGTGTAACACTCATTTTGTTTATCATGTATAACAATTAATAAAATGTACTCTACTAACATATTAAAGTAAACTTA TTTTAATGTTACTATTTTATGCTAAAAATTTATAAATCCATACAAAAAATGTTACATTTACTTCAAAAGGAAATTCTTCC TTTCATCTTTTTTCACTTTAAATGTGACCGGAAAAGTAGCTCTCTAGTGGGGCCAATCAAGTCCAAAGTTTAAGTTGACA GCTAGCGCATGGTTTGGGGGTGGACTCTTGGGGCATTGTTGCATTATACAATAGGATTCTTGAATCTTTATTGACCTACT CATATGTGGATATAGAATTTCTGTCTAATTTTTAGTGTTTTAATTAGTAACTAACTAATTAGACCACACCACATTATCAC ATGATAAACATAAAAGAGTTATTTAAATAGTAATTTAAAATTTTTTATACGACGTGTCATAATATGATTGATTAAACACC AATTGAAACACTAATGACTCGTTTACTTCGCGGATTCGAGTTTCAATTCGAGCTGAGATGTGATATTTTCTGAGAGTTTT CACTGTAGCAGAAAAAGTTAGATGTGATATTTTTTGAGAGCTTTTTACTGTAAAAACTTAAAATTAAAAACTTGAATCGG TGAAATGAACGATGCCTAAAGTTAGACAGGAGAATGTGATACCATAAATGAGACCTAACTGTCCCATAACCATTTCATTT CAACTCCACAATCAAGTCTTGTAATTGTCTTCCTTTTCTAAAGCACACTACAAGAATAGTGACGTTAAGAGACCAACCCT TTTGCTACTAAAATATTTTTGGTAGCAGAAAACACACTTTTTGCTACCAAACTTTGGTAGCTGAAGTATCAAGGCTTTAG TTATCAAATTTGGTAGCAAAAACAACACAATCCGCTACCAAATATAATTTGGTAACAAATAACATGGCGGGAAAAGAATT TTGGTTCCCGCCAAGAGCTTTTTGCTACCAAAATAATATTTGGTAACAAAAACATAAGATTCTGCTACAAAAAATTTGGT AACAAAATATGACTTTTTTACTACCAAAATGTTTTGGTAACAAAAAGTTGGCGGGAAGCAATTTTTTTTCCCGCCTGAGG TATTTGCTACCAACTTATTTTTGGTAGCAAAACATATAACATTTACTACCAAGAATTTGGTAGCAGAATCATATTTTTTG CCACCAAAAGCATAATTTGTTGCTACCAAATTTTAGTAGCAAAAAATCAAGTTTTTGCTACCAAAAAACATAATTTTTTG CAATTAAATTTTGGTAGCAGAAAACATGATTCTGCTACCAAATTCTTATTTTGATGACAAAAAAGCGTTTTTTGCTACCA AAAGTTGTGTTTGGTTCTGTTCTTGATTTCATTGCCGTCCAAGACTCTCGTGGCCTCATTCTTGATTTCTTAAACCATTG ATTTCTTAAACCATTGATTTCATTTCGTTCTGTTCTTAAACCATTGATTTCTTGATTTCATTGCCGTCTGTAGAGTAACA AAAAAACATGGTCCTCCACTAGGGACAATACGTAGTAAGAATGAGAAACAAAAGAACATGGTCCTTTGCTGGGTACTATG CGTTTTTTAGTAGCATGAGTAAAAACAAATGGTCCTCCACTGGGGATTATGCTATTTTAGTGGAACAATAATAATGAGAT AACAAAATAACATTGTCCTCCACTGGGGACTATTCTTTTTTAGTAGCATAATAAGAATGAGTGATAAAAAATGGGGGAGT TATGCTAAATACAGACTCTTTTACAGATTCTACTAATAAAGCAAGTTACGACCTGGTAAAAGGAGAGAGAGGCTGGTGAA CGGAGTGAGGGAACCTGCTTCGAACGACGAGGAGAGGAGAGGAACAAAGAAAAATTCCCGGATAAGTGCTTTTTCTCTCC TAAAAGCAATACCAAACCCACCCTATAGATATGTGATATTGTTAACTAAGTATATGTTCCACATAGAACAGTATATAATT TCCTTATTTGATTGATTTTTAACTTTGAATAATGTATCTCAATTTCAAAACTATATTTTTTGTTATAATGTTGTTAGAAC AATGATTCTTAAATAATTTTTGACATTAAAACGTTATTTTTTTTAATCTTTAATATATGTCTTTCTGGTACCAAATTCAT ATTTGGTAGCAAAAAGTATGCTTTCAGCTACCAAAATATTGTTTGGTAACAAAAAATATAAGTTTCTGGTACCAAATTTT GGTAGCAGAAAACATGATTCTGCTACCAAATTCTTATTTTGGTGGCAAAAAGAAATTTTTTGCTACCAAAAGAACCAAAA CATTTTTTTGGTAACAAAATAAAGAACGAAATATTGGTGGGAAAATCAAGAAACACTTCGCCATCTTCGCATCTCTGCCA GAAATTCCTCCGCCTTTCTTCCTCTCTCTCGCTCCTTCTCTCTCTAGCCGCTGATTCTCGGCGTCGTAGGCTCCGATTCC CGCTTCCGCCGCCTTCGATTGTCGCTGTCGCCGCCGCCGATTGTCGTCGTTGCTGACAAACGCAAGATCTCTCCTCTCAC TATCAACGCCTCCTCATTTCCGGTTAGTTTTATCTCCCTTTCTTTCCCTTTCTCATCGTGGAAAAGTTTTTATTTTTATA GCATTTTAGGACTAGAATCAGTTTGAATAAGTTTGAATCTATTTTGAGCCTTTAGGACAAGAATCTGTATTGGATATATG CTTTTCTTTTTTTCTTTGAAGTTGTATTCTTATTTTGACGTTGCTTCCTGGCTTCATGGCTTTGACATTGATTTCCGGTC ATTCGGATTAAGTTGCTTCCTGGCTTTTCTTAAGTTGATTTCCGGTCCTTCGGATTAATAAGACATTTGGCAAAGTTGAA AAAAATTGACTATTGACTGTATTATACTATATTGACGCATGAAGTGGCAGTTCGCCAGCAGATATTTGTTTGCATTTGTT TAGCCAGCAGACATTAGGCACCAACCTTTAATTCGTAGATCTACTACCATGTCAGATATGGATAAGAGTTAGATTTATGT GACAAACTGACTTTCAGAGACATATATGGATGGAGTTAGAAGATTTATTGAACAAGCACGTAATCACCTAGATGCGGATG GAAAATGTCGTTGTCCTTGCAAAAAATGTTTGAATTGTTTTTTCCATCATATAGACATTGTTGAGCGTCATATTTTTGTT AGAGGTTTTAGCTTAAATTATATAAACTGGATTAATCATGGCGAGGAGGAAACCGATACTACTCCCAATGTACAAGATGA AGACTATGATGCAGAAGGAGAAAAAAGTGACAATGATGACGACAAAGATGAGATGGTGGATGCATTAAATGATGCATTTC TGCACGTCAATCCATGTTCAATGGATGATGGTGCAGAAATAAATGATATTGGGGGCTGCGAAGAAGAGACACCTAATTTA GAAGATTTGTTCGCTGAAGCGGAGAGGGAGTTATATAAAGGATGCACAAAGTTTTCCACATTGACTTTTTTGGTGAAGTT ACTTCATATAAAAGTATTGAATCAATGGAGTAACAAGTCTTTTGATATGTTGTTGAAGTTACTTCGGGAGGCATTTCCAG AAGGCTCGAGAATTCCCAAGTCTTATTATGAGGCGAAGCGGATGATGCAGAAGCTTGGGTTGGGATACAAGACCATCCAT GTGTGCCCGAAGGAGTGTGTGTTGTATTACAAAGAGTACAAAGATTTGAAGGAATATCCGGTATGTGGTCATAAGAGGTA TAAAAATTGTAATGCAAAGGAGAAAAAAGTTCCCCATAAAAAAATGCACTACTTTCCTCTCATTCCAAGATTGCAGCATT TATTTATGTCTCAACACACCGCTGAATATATGAGGTGGCACAAGGAACAACGTTTTGAGACAGAAAGAGTCATTCGACAC CCTACTGATGCGGAAGTGTGGAAGGAATTTGACAAACAATATCCGGATTTTGCAGATGAACTGTGTAATGTCAGATTAGG TCTTGCTTCTGATGGTTTCACGCCGTTTGGAGATATGACAAATCCATATAGTATGTGGCCAGTTTTACTGGTGTCTTACA ACATGCCCTCTTGGAGATGTATGAAGCAGGCACATATCATGATGTCGACATTAATTCTGGGACAGAAGGCACTGGGGAAA GACATAGACATTTATTTGAGACCTCTAATTGATGAACTTAAAGAGTTATGGGAGAACGGCGTTAGAACGTACGACGTAGT TGAAAAAAAAACAATTTACTTTGTGTGCTGCAATATTATGGACAATTAATGATTTTCCTACATACGGTACTTTATCTGGC TACTCCACCAAAGGATATGAGGCTTGTCCTGTGTGTATGGATGAAACCGCTTCATTCTGATTACAGAGTAAGATTTGTTA TATGGGACATCGCCGTTATTTAAGTCTGGATCATGCTTGGCGCTCCAACTTGAATTTTGATGGTTCTGTTGAAACAAGAA TGCCTCCCGAATCAAAAACGGGCGAGGAACTATTGTTAGAGCTAAGCAAGCTGTGGGTTCCTATGCCGGGAAAGGATGTA GCAGTTCATGAAGCTGACATGAAAAAAATGTCAGAAGCTGGGTACTCAAACGATAGTAATTGGAAACGGAAAAGTATCTT TTGGGAGCTCGAGTATTGGTCGAAACTTAAGTTGCGTCATAATCTTGATGTAATGCATATAGAAAAAAATATATGCGATA ACTTGGTGGGAACCGTGTTAGGAATAGATAGCAAGTCAAAGGACACCAAAAAAGCTCGCTTGGGCTTACAAGAGCTGAAT ATAAGAAAGGAGTTACACTTGGATGGTAAGGGGAAAAAGCCTCCGGCATGTTTTACATTGTCTACTATGGAGCGGAAAGC TTTTTGTCAATTTTTGAAATCAGTCAAATTTCCCGATGGATATGCAGCAAATTTGACCCAAAATGTCAACATTAACGATG GTAAAATCATGGGTTTGAAAAGAGAGGTGACTCTTGGAAAGTAGTTCAAAAAGTCAATCACCGTCATATATGGGAGAATG TATCAAAAACAACAGTTGAGGCTTGTCAAGAGGATGAAGAAGATAACAAGCCTTATCAAGAAGAGTTATCAAATGAGGTT AACATTTCATTTGACACCACAAATGTTAATGAAGCTCCCTTAAATCATATGGATATTGGGCCACTCAAAATTGATGGTTT CACCATTGATATTTGCATCGATCCCAATGACGAAATCGATGATGAAACAGAAGAGGAAATTGAAACGGAATTCAATGGAG AAGCCGATGATGAAATTGATGGTGACACCGAGAAAATTGATTCCGCAACTGATTATAGTGATTGATTAGGTCAAATTATT TCAGTTTAACTTTAAAATGTGCATTTGTGATTGTTTGAAGTAGTTGTAAAACTGTGACAAGATTTGAATATACCATACCT CCAATCACTAACTTCTATTTTTATTTTTATTGTTTTAGGATATTAGTTATGTCTACTCGTAAGAGAAGCTATCATTTAGT TATGGTTCAAAATCCAAATATGCTCTATCTCTGCCGGATGTTAACGCATCTCCCCGGACTCCTTCAGTGGCATCTTTAGG CACATTAGGCTCATCCACATCTTCACGAGCAGATAATGAGCCATCGTAAGATTTTCAACAATTTCATGAGGATCATCCTC TGGAGATTCTACGTATTGAAAATACACGTAAGATCATAATAATTATTTTTAATTGAGTTTTTTTTTACACTATTCTACAT TTAACCTCCTTTGTAAACAACACGGTCAACAAATGTTCGAGGACTAACTACATGTCAAGGAATTAACAAGTTAGTGTCCA AGAAAGGAAAACTTCAAGTACAATTTAGAGAATCTGAGCTTCGAGTTTACGGGGAGCATGCGGGCCTATTTGCGAGCAAA ATCGGCTCTATAGTTTGCCATCATGCTCCATTAAAGTATAGTGGTTGGGGTAAAATTCCTGAAAATGAACAAAATAAATG CATAAGACGATTGAAGGTAAAATTTTCTATTGTAACTTATTCTTTATAACAATTGCACTTATATAAGAACAAATTTAGCA ACTTTTTTTTCTTCAAGATCTATTTGATTTAGATTTTGAGGCGCATCCACAATTGAAAGACATTGTACATCAATATTTCT ATGAGCACTTTAAAGGTTATCGATATCGGTGCCACCAAAAATATCAGGCCATTATTGAAGAAGGAAAAGATCCATTGCAA CATTTACCGAATCAATAATGAATAACTTAACTGTATTATGAGATGTTTGTTTGAGAATGTGGTTTTGGATATGCAAATTG AACCAATATATGTGGTTTTGGATTTTCTGGGTTAATTAAAATTATAGGGGAGATGATGTCGAAATTTCTATTATATTTTA ATGCATTTAAATGTTTCTTTTTTCATTTATATAGAAAAAAACACAGGTTGTTGCGGAAAATCATTCCAAAAAGCCAGCAG GTTATTTGGGTGGCTCAAGATCTATAGTTCAACATTTGGAGGAAGTCCATGTAATTAACTTGCACTCACTTAAGTATACT ACCACTTGAAACCATAATTTCTTTTTTCTTTTTAACTAACTAACAAATAATGATTTCTATGTAGAACACACATTCAAGTT CTGACTCAAATGCTTCGGGAAGGTATTTTGAGGTCTTCAAGAACACTCATTGGAGCGAATCATGGGGATGGACAACTCAG AGAGCAAAGGAAGATTATATAAGAATTACTAAACACTTTATCATTTTGTTTGATTTTATATTTTTTTTACTCTAATTTGA AAGTTTATAACACTTTGCCTAATGCAGGAACAAATGATCAAGATCCGCGATGCTCGTTTAAGTGAAGCACTAGATGGGTA AGAACTTGACTCTGATGTAGAGGAAGAAATTTACTCTCAAGTTTTGACAAGTAAGAGGTATGAAAAATATGGTTCCAAGC GTGGCATAGGTCCTGTACTAAGAAAAGCGCCACAAGGTCGCAAATCTAGAGGTTTAGGATATGAAAAACTTGAAAATGAA GTTCAGAAAATAAACGTCGTATGTCGGATATGTAAATCCTAATGAAGCAACAACATAAGCTTATTCAAAAGCTACTTCAA CAAATAAATCCGCCGTCCGATCATCCTAGACCTTCCATCCCAAGAATAGAAGATCCTCCACCACCGCCACCACCGGCCTC AATTTGTTAGAGCGTTTCATTTTTGTAATACTAAGATTTTATTAGTACAATATTTACATAAATGTTTGGGTTTGTTTAAG TATGACTATTTAGTATTTTGTTTGGATTCTAATATGTATTGAAATATTTAGAGATTTTTAAATTAATATTTGGTATTTTA TTTATATATATTTTTTCAAAAAATACAAGTACATAAATCTGTCTATTTGTACTAAATATTTGGTACTTGATTCTTTTTGC TACCAAATATATTTTGTTACCAAAATTTTGGTAGCAAAAAGCTCACACTTTTTGCTACCAAATATATTTTGCTACTAAAA TTTTAGTAGCAGAAAGTTCATACCTTTTGCTACCAAATATATTTGGTTACCAAAATTTTGCTAGCAGAAAGCTCGCACTT TTTGCTACCAAATACCTTTTGCTACCAAAATTTTGGTAGCAAAAACCTCACACTTTTTGCTACCAAATATATTTGGTAGC AGAAAGGTCACACTTTTTGCTACCAAATAGATTTTATTACCAAAATTTTAGTAGCAGAAAGCTCACTTTTTACTACCAAA AACCTTTTGCTACCAAAATTTTGGTAGCAAAAACCTCACACTTTTTGCTACCAAATATATTTGGTAGCAGAAAGGTATTT TTGGTAGTAGAAAGCTCACATTTTTTGCTACCAAAAACCTTTTGCTACCGAAATTTTTGGTCCCCGAATATCATACATTT TGCTACCAAATACATTTTGTTACTAAAAAATTTTTTGGTAGCAAAGACTATTTGCTACCAAAAATTAGGTAACTAATGCT TTCTGCTACTCACTTTTTGCTACCAAACTTTTTTGGTAACAAAAACATTTTGCTACAAAAAACATGACTTTTGGTTACCG AATTTTTGGTAACAAAAAATTCAAGTTCTTGTAGTGGCCGTCACAATCTTTAATTTGTTTACACTCATTAAACCATGTAG GGATATTGATAACGATTAGATTCCTTCCTCTTTTGTGATTCACATGAATGCTCGTTATTTATTTATTTATTTTAGTTTCA ATATTGTATAAAACATATATTGGTCGTTGTGGAACTGAAGGCTATTTCAAACATGGGAAAAATTACAAGAGAGCAAAGAA CAAAAGATTGGTTTTACAACACTTCATGAGTCACACACTTTGTTGATAATCCCCATCAACATTTTTATGAACACATAAGT ATGATTAAGACCAACATTCAAACTCACCGCAAAAAAAAAAAAAAAAAAATTAAAAAAAACAACACTAACAGATTGGAAGA GGTTCACCATTCCAGCCACTAAGGCACTCCAACATTGGATCAATAAGCTTGCCTTGGCACATGGCAGTATAAACCTTGTC AAATTCCTCCCCTGGTGATCTAACTTTCTCACCTGTTAGCAAACTAGTCCCCAACTCCTCCCTCACAAACTTGTACAAGG GGTAAGACCGGCACTCGGTGATCTTGTTCGAAATCGCGGCGTTCCCGTTCTCATAAGCGATCCTTGCGCTCTCCACCTCC TTAGGCAAAAAGGATTTCAGCTCCTCCTCAAAGGCTGCAATCTTTTGAAAGATTGAGGTGCTCGTGTTCTTCTCGCTTTC ACCGTTTGTCAGTGCGTGCTCGACGAGTACTTGCCTCAATGTTTGCATCAACGGGTAGGTAGCACTGCAGGGGTCATCAA TGTAGGTATAGACATATTCCCTGTCCACCACTTTGAGGAGATCCTTCTCGCAGAACCTCGACGGGTTAAGCTCTCCGTTT ACGCCAGTTGTTAGCACTCTCTTCACCACTTGGCTCACGGTGTTCTTAACCGTGTGCTTCAAATTCTCCTCCAAGTGCCT CAAGTCAATGGCTTGGCATAGACCCACCAAGAATGTGGTGGACATGAGCTTGAGAATGTCAATTGACTCTGCGGTTTTAC GCGAAGAGATCAATCCCAAAGAGTTCACATCTTGGTTGTGTTGCTCAGCACTTTGGACATGGCTAGTG >DTC_2_2_Mno length=10419;Class=DNA transposons;Order=TIR;superfamily=CMC; CACTACAAGAATAGTGACTTTAAGAGACCAATTCTTTTGCTACCAAAACATTTTTGGTAGCAGAAAACACACTTTTCGCT ACCAAACTTTGGTAACTGAAAGTATCAAGGCTTTAGTTACTAAATTTGGTAGCAAAAACAACACAATCCGCTACCAAATA TAATTTGGTAACAAATAACATGGCGGGAAAAGAATTTTGGTTCCCGCCAAGAGCTTTTTGCTACCAAAATAATATTTGGT AACAAAAACATAAGATTCTGCTACCAAAAATTTGGTAGCAAAATATGACTTTTTTGCTACCAAAATGTTTTGGTAACAAA AAGATGGCGGGAAGCAAATTTTTTTCCCGCCCGAGGTATTTGCTACCAAATTATTTTTGGTAGCAAAACATATAACATTT GCTACCAAAATTTTGGTAGCAGAATCATGTTTTCTGTCACCAAAATTTGGTAGGAAAAAATTAAGTTTTTGCTACCAAAA ACATAATTTGTTGCTACCAAATTTTAGTAGAAAAAAATCAAGTTTTTGCTACCAAAAAACATAATTTTTTGCTACCAAAT TTTGGTAGCAGAAAACATGATTCTACTACCAAATTCTTATTTTGGTGACAAAAAGGCGTTTTTTGCTACCAAAAGTTGTG TTTGGTAGCAAATCATATAAAACATTAATATTTATATTTTCTGCTTGTATTTTTTTTTTTTCAATTTTCTATGAATATGT CCTATATTAAGTTTTAACAATCCATCCTACTGTATTTTTTATAACAATTATTTGATAATTTAATTATTTTGTGTAGGTGT AGCAAGAGACATGTTCATATGTATATATATGTAATATTATTAACTAAGTATATGTTCCACATAGAATAGTATATAATTTC CTTATTTGATTGATTTTTAACTTTAAATAATGTATCTCAATTTCAAAACTTTTTTTTTTGTTATAATGTTATTAGAACAA TGATTCTTAAATAATTTTTGACATTAAAACGTTATTTTTTTAATCTTTAATATATGTCTTTCTGGTACCAAATTCATATT TGGTAGCAAAAAGTATGCTTTCAGCTACCAAAATAATGTTTGGTAACAAAAAATATAAGTTTCTGGTACCAAATTTTGGT AGCAAAAAACATGATTCTGCTACCAAATTCTTATTTTGGTGACAAAAAGGGATGTTTTGCTACCAAAAGTTGTGTTTGGT AGCAAATCATATAAAACATTAATATTTATATTTTGTGCTTGTATTTGTTTTTTTTTTTTTCAATTTTCTATGAATATGTC CTATATTAAGTTTTAACAATCCATCCTAGTGTATTTTGTATAACAATTATTTGATAATTTAATTATTTTGTGTAGGTGTA GCAAGAGACATGTTCATATGTATATATATGTGATATTGTTAACTAAGTATATGTTCCACATAGAATAGTAGATAATTTCC TTATTTGATTGATTTTTAACTTTGAATAATGTATCTCAATTTCAAAACTTTTGTTTTGTTTTGTTATAAAGTTATTAGAA CAATGATTCTTAAATAATTTTTTACATTAAAATGTTATTTTTTTAATCTTTAATATATGTCTTTCTGGTACTAAATTCAT ATTTGGTAGCAAAAAGTATGCTTTCAGCTACCAAAATAATGTTTGGTAACAAAAAATATAAGTTTCTGGTACCAAATTTT GGTAGCAAAAAACATGATTCTGCTACCAAATTCTTATTTTGGTGACAAAAAGGCATGTTTTGCTACCAAAAGTTGTGTTT GGTAGCAAATCATATAAAACATTAATATTTATATTTTGTGCTTGTATTTGTTTTTTTTTTTTTTCAATTTTCTATGAATA TGTCCTATATTAAGTTTTAACAATCCATCCTAGTGTATTTTGTATAACAATTATTTGATAATTTAATTATTTTGTGTAGG TGTAGCAAGAGACATGTTCATATGTATATATATGTGATATTGTTAACTAAGTATATGTTCCACATAGAATAGTATATAAT TTCCTTATTTGATTGATTTTTAACTTTGAATAATGTATCTCAATTTCAAAACTTTTTTTTTGTTATAATGTTATTAGAAC AATGATTCTTAAATAATTTTTGACATTAAAACGTTATTTTTTTAATCTTTAATATATGTCTTTCTGGTACCAAATTCATA TTTGGTAGCAAAAAGTATGCTTTCAGCTACCAAAATAATGTTTGGTAACAAAAAATATAAGTTTCTGGTACCAAATTTTG GTAGCAGAAAACATGATTCTGCTACCAAATTCTTTTTTTGGTGGCAAAAAGAAATTTTTTGCTACCAAAAGAACCAAAAC ATTTTTTTGGTAACAAAATAAAGAATGAAATATTGGTGGGAAAATCAATTTAACCTTAAAAATTAAGCGCGCGCACACAC ACACACACACACACACATCAGTTTCATTAAAATAAAAAAAAAAAAGCCATTCCCCTTCTACCTCAGAAGCTCTGCCGCCC GAAGAAGCCATTTTTCCCCTTCTTCGGAAACACTTCGCCATCTTCGCTCAATGCCAGAAATTCCTCTGCCTTTCTTCATC TCTCTCGCTCATTCTCTCTCTAGTCGCTGATTCTCGGCGTCGTAGGCTCTGATTCCCGCTTCCGTCGCCTTCGATTTTCA CTGTCGCCACCGTCGATTGTCGCTGTCGCCGCCGCCGATTGTCGTCGTTGCTGACAAACGCAAGATCTCTCCTCTCACTA TCAACGCCTCCTCATTTCCGGTTAGTTTTATCTCCCTTTCTTTCCCTTTCTCATCGTGGAAAAGTTTTTATTTTTATAGC ATTTTAGGACAAGAATCTGTTTGAATCAGTTGAATCTATTCATCTTAAGCAAGCTCAGATCAGGTTTCTATTCATTTCAT TTGTTGCTAATTTGGGCTTTTTTGTTTTTTGTCTCTAAGGTTGAATTCGATTATTCTGGTGCATTTAGGGATATGGCTGA ATATTTGATGGTTGTTCTGATTGAAATGTGAATGTGGGCTTTGTGTTCTTTTCTTTTGTTTTGTTTAATTCAAAAAGTTG TATTGGCTTTTTCAGGTCGGTAATTAATGGCTTTGGTGAGTATTTGATTTTCGTTTTAGCTGAAATATGAATGTGGGTTT TGTTTTTTTGGTTTGCTTAGGCCTTGGACTTGGGAAGTACGTTTTGGTTTAGATTGGTAGATACTTCATTTCTTTATTTC TAAAGTTGCATTGGCTTATCAATTTTGTTTGATTGTATTTTATGTTGAAATGAGATTGTGGGTTGTTGCGTTGTTATATT TTGGCTATTGTTCTTTTTGTTTGGTAAGAATCAGGGAATTTATAAATTTTTGAATCATGATAGTGTATTGGATATATGCT TTTTTGTTTTGAGTCTGTTTTGAGCCTTTAGGACAAGAATCTGTATTGGATATATGCTTTTCTTTTTTTCTTTGAAGTTG TATTCTTATTTTGACATTGCTTCCTGGCTTCATGGCTTTGACATTGATTTCCGGTCATTCGGATTAAGTTGCTTCCTGGC TTTTCTAATAGGTATAGTTAGAACAACTTGCTTTAAGAACACATGCATGGCAACCACTTCCTAATGAACTCAAATATTGT TTACCAAAAAACGACCTTAAAATGTTGTCTATCTAACTACAACCTGCAGGTTCACACCAATTAGTTTGTTTTAGAAAGAG GGGGAAATTTGGTCAAACATTTGTTTAACATATTTGTATAAGTTATGGCTTTCGAAAATTTGAAAGGAGATGAGCGTCCA AAAGTTTGAATAATACTATATTGACGATCATTCGGATTAACAGGACATTTGGCAAAGTTGAAAAAAATTGAATATTGACT GTATTATACTATATTGACGCCTGAAGTGGCAGTTCGCCAGCATACATTTATTTGCATTTAAAATTTATTTGCATTTGTTT AGCCAGCTGACATTAGGCACCAACCTTTAATTCGTAGATCTACTATCATGTCAGATATGGATAAGAGTTGGATTTATGTG ACGAACCGAATTTCGGAGACATATATGGATGGAGTTAGAAGATTTATTGAACAAGCACGTAATCACCTAGATGCGGATGG AAAATGTCGTTGTCCTTGCAAAAATTGTTTGAATTGTTTTTTCCATCATGTAGATATTGTTGAGCGTCATATTTTTGTTA GAGGTTTTAGCTTAAATTATATAAACTGGATTAATCATGGCGAGGAGGAAACCGATACTACTCCCAATGTACAAGATGAA GACTATGATGCAGAAGGAGAAAAAAGTGACAATGATGACGACATAGATGAGATGGTGGATGCATTAAATGATGCATTTCC GCACATCAATCCATCTTCAATGGATGATGGTGCAGAAATAAATGATATTGGGGGTTGTGAAGAAGAGACACCGAATTTAG AAGATTTGTTCGCTGAAGCGGAGAGGAAGTTATATAAAGGATGCACAAAGTTTTCCGCATTGACTTTTTTGGTGAAGTTA CTTCATATAAAAGTATTGAATCAATGGAGTAACAAGTATTTTGATATGTTGTTGAAGTTACTTCGGGAGGCATTTCCAGA AGCCTCGAGATTCCCAAGTCTTATTATGAGGCGAAGCGGATGATGCGGAAGCTTGGGTTGGGATACAAGACCATCCATGT GTGCCCGAAGGAGTGTGTGTTGTATTACAAAGAGTACAAAGATTTGAAAGACTGTCCAGTATGTGGTCATAAGAGGAATA AAAATTGTAATGCAAAGGAGAAAAAAGTTCCCCATAGAAAAATGCACTACTTTCCTCTCATTCCAAGATTGCAGCGTTTA TTTATGTCTCGACACACCGCTGAATATATGAGGTGGCACAAGGAACAACGTGTTGAGACGGAAGGAGTCCTTCGACACCC TGCTGATGCGGAAGTGTGGAAGGAATTTGACAAACAATATCCGGATTTTGCAGCTGAACCACGTAATGTCAGATTAGGTC TTGCTTCCGATGGTTTCACGCCGTTTGGTGATATGGCAAATCCATATAGTATGTGGCCAGTTTTAGTGGTGGCTTACAAC ATGCCCTCTTGGAGATGTATGAAGCAGGCACATATCATGATGTCGACATTAATTCCGGGACGGAAGGCACCGGGGAAAGA CATAGACATTTATTTGAGACCTCTAATTGATGAACTTAAAGAGTTATGGGAGAACGGCATTAGAACGTACGATGTAGTTG AAAAAAAAACAATTTACTTTGCGTGCTGCAATATTATGGACAATTAATGATTTTCCTGCATACGGTACTTTATCCGGCTA CTCCACCAAAGGATATGAGGCTTGTCCGGTGTGTATGGATGAAACTGCTTCATTCCGATTACAAAGTAAGATTTGTTATA TGGGGCATCGCCGTTATTTAAGTCCGGATCATGCTTGGCGTTCCGACTTGAATTTTGATGGTTCTGTTGAAACAAGAATG CCTCCCGAATCAAAAACGGGTGAGGAACTATTGTTAGAGCTAAGCAAGCTGTGGGTTCCTATGCCGGGAAAGGATGTAGC AGTTCGTGAAGCTGACATGAAAAAAATGTCAGAAGCTGGGTACTCAAACGACAGTAACTGGAAACGGAAAAGTATCTTTT GGGAGCTCGAGTATTGGTCAAAACTTAAGTTGCGTCATAATCTTGATGTAATGCATATAGAAAAAAATATATGCGATAAC TTGGTAGGAACCGTGTTAGGAATAGATGGCAAGTCAAAGGACACCAAAAAAGCTCGCTTGGGCTTACAAGAGTTGAATAT AAGAAAGGAGTTGCACTTGGATGGTAAGGGGAAAAAGCCTCCGGCATGTTTTACATTGTCTACTACGGAGCGGAAAGCTT TTTGTCAATTTTTAAAATCAGTCAAATTTCCCAATGGATATGCAGCAAATTTGTCGCGAAATGTCAACATTAACAATGGT AAGATCACGGGTTTGAAAAGTCATGATTGTCACGTGTTGTTGCAACGACTGTTGCCGATAGGATTGCGGCCTTACTTGAA AGACAATGTGTTGGGTCCGATTGTTGAGATGTGTTCATTTTTCCAGCAGCTTTGTGCAAGGACATTGTCAGTAAAGGACT TAGATGCACTACAAGAAGGTATAGTTTACACATTATGTAAACTTGAGAGGATTTTTCCTCCTGCATTCTTTGATGTTATG ATCCATCTAGCCTACCATTTACCAGAGGAAGCAAAATTAGCTGGACCAGTGCACACTAGGTGGATGTACCCTTTTGAAAG GTATCACTCTATTTAGTGGATTTATGTATATGTTTAGAGATTTTCCTAATGATGAACATGTGTACTTTCTCGGGAGTTAT ATCATAGGACACTAGGGAAATTGAAGAAATATGTTAGAAATAAAGCTCGTCCAGAAGGCTCGATTGCAGAAGGTTATACT ATTAGTGAGGCATTGACGTATTGTTCAATGTACATGCGTGACATTGAAACACAGTTTAATCGGCCCGAACGTAATGCAGA CAATATCGAAGCCCGACCATCCTCATCAATTTCAGTTTTTCATCAACGTGCGAGACTGTTTGGGAAGCCAAAGGCTATTA TGTTGACACAAGATGAACGTGAAAAAGTACGTTGGTATATTCTAAATAATACTGAAAAGTTGCAGCCATATTTGGAGTAA GATATTGATCCTTATGTGTACCTTCTCAATTCCTTTTTAGAATAACGAAATTTAACACATAATCATTGACAGTGAACATG TTTCATTATTGCGATCCGAAGGCGTTGATCTTATTGATATTCAGCGTACCCAAATATCAACCTTTGCAAAGTGGTTTGGA AATAAGGTAAGACAATGCTTGCTTTCATTTGAAATATGAATTTATAGTGAATGGCGTTCTTCTTAATATCTTACATCAAC ATTGATGCAGATTAGAGACAAATATGCAGAAGATGATACAACTATCTCTAATGACTTGTATGCTCTGGCAAACGAACCTA ACATTTTTGTTCACTCATACCCTGGTTGTATGGTGAATGGAGTGCGATATCATACTAAAATGCGAGATGACAAGCATACC ACACAGAATTCTGGTGTTTACGTTGAGGGAGATTGTGATGGGGTAATAAGTGATTTCTTCGGTGTGATTGAGGAGATTTG GGAGGTGTCATTTTTGTATTGGAATAAGGTGATCTTATTTAAGTGTTCATGGTTTGATACTGCCAATGGAAGGATGAAGA AAGAGTATAATTTCACCACCATTAAAACTGATTCATTATGCTTTGAGGATGAACCGTACGTCTTGGTAGATCAAGTGAAA CAAGTCTATTACATTAATGATGAAAAGAGAGGTGACTCTTGGAAAGTAGTTCAAAAAGTCAATCACCGTCATATATGGGA GAATGTCTCAAAAACAACAGTTGAGGCTTGTCAAGAGGATGAAGAAGATAACGAGCCTTATCAAGAAGAGTTATCAAATG AGCTTGACATTTCATTTGACACCACAAATGTTAATGAAGCTCCCTTAAATCGTACGGATATTGGGCCACTCGAAATTGAT GGTTTCACCATTGATATTTGCATCGATCCCAATGACGAAATTGATGACGAAACAGAAGAGGAAATTGAAACGGAATTCAA TGGAGAAGCCGATGATGAAATTGATGGTGACATCGAGAAAACTGATTCTGCAACTGATTATAGTGATTGATTAGGTCAAC TTATTTCAGTTTAACTTCAAAATGTGCATTTGTGATTGTTTGAAGTAGTTGTAAAACTGTGACAAGATTTGAATATACCA TACCTCCAATCACTAACTTCTATTTTTATTTTTATTATTTCAGGATATCACTTATGTCTACTCGTAAGAGAAAGCTATCA TTTAGTTCTGGTTCAAAATCCAAATCCGCTCCATCTCTGCCGGATGTTGACGCATCTCCCCGGACTCCTTCAGTGGCATC TTTAGGCACATTAGGCTCATCCACATCTTCACGAGCAGATAATGAGTCATCTCATGATCATCAACAATTGCATGAGGATC AACCTCCGGAGATTCTACGTTTCAATACACGTAAGATCATAATAATTATTTTTAATTGAGTTTTTTTTTTTACACTATTC TACATTTAACCACCTTTGTAAATAGCATGGTCAACAAATGTTTGAGGACCAACTACATGTCAAGGAATTAACAAGTTAGT GTCCAAGAAAGGAAAGCTTCAAGTACAATTTAGAGAATCTGAGCTCCGAGTTTACGGGGAGCATGCGGGCCGATTTGCGA GCAAAATTGGTTCTATAGTTCGCCATCATGCTCCATTAAAGTATAGTGGTTGGCGTAAGATTCCTGAAAATGAACAGAAT GAATGTATAAGACGATTGAAGGTAAAAATTTCTATTGTAACTTATTCTTTATAACGATTGCACTTATATAAGAATAAATT TAGCAACTTTTTTTTCTTCAGGATCTATTTGATTTAGATTTTGAGGCGCATTCACAATTGAAAGATATTGTACATCAATA TTTCTATGAGCGCTTTAAAGGTTATCGATATCGGTGCCACCAAAAATATCAAGCCATTATTGAGGAAGGAAAAGATCCAT TGCAACATTTACCGAATCAATACATTAAACCAGATGATTGGGAGTGGATGTGCACCAATTGCTTTGGCGATGATCAATGG CAGGTAAAATGAACAACTTAACTGTATTGTGAGATGTTTGTATGAGAATGTGGTTTTGGATATGCAAATTGAACCAATAT ATGTGGTTTTAGATTTTCTGGGTTAATTGAAATTATAGGGGAGATGATGTCGAAATTTCTATTATATTTTAATGCATTTA AATGTTTCTTTTTTCATTTATATAGAAAAAAGCACAGGTTGCTGCGGAAAATCATTCCAAAAAGCCAGCAGGTTATTTGG GTGGCTCAAGATCTATAGTTCAACATTTGGAGGAAGTCCATGTAATTAACTTGCACTCACTTAAGTATACTACCACTTGA AACCATAATTTCTTTTTTCTTTTTAACTAACTAACAAATAATGATTTCTATGTAGAACACACATTCAAGTTCTGACTCAA ATGCTTCGGGAAGGTATTTTGAGGTATTCAAGAACACTCATTGGAGCGAATCACGGGGATGGACAACTGAGAGAGCAAAG GAAGATTATGTAAGAATTACTAAACACTTTATCATTTTGTTTGATTTTATATATTTTTTTGACTCTAATTTGAAAGTTTA TAACACTTTGCCTAATGCAGGAACAAATGATCAAGATCCGCGATGCTCGTTTAAGTGAAGCACTAGATGGGTCAGAACTT GATTTTGATGCAGAGGAAGAAATTTACTCCCAAGTTTTGACAAGTAAGAGGTATGAAAAATATGGTTTCAAGCGTGGCAT AGGTCCTGTACTAAGAAAAGCGCCACAAGGTCGAAAATCTAGAGGTTTAGGATATGAAAAACTTGAAAATGAAGTTCAAG AAAATAAACGTCGTATGTCGGATATGGAAATCCTAATGAAGCAACAACAGGAGCTTATTCAAAAGCTACTTCAACAAATA AATCCGTCATCCGATCATCCTGGACCTTCCGTCTCAAGAATAGAACATCCTCCGCCACCGCCACCACCGGCCTCAATTTG TTAGAGTGTTTCATTTTTGTAATATTAAGATTTTATTAGTACAATATTTACATAAATGTTTGGGTTTGTTTAAGTATGAC TATTTTAGTATTTTGTTTGGACTCTAATATGTATTGAAATATTTAGAGATTTTTAAATTAATATTTGCTATTTTATTTAT ATATATATATTAAAAATACAGGTACATAAATCTATCTATTTGCTACTAAATATTTGGTACTTGATTGTTTTTGCTACCAA ATATATTTTGTTACCAAAATTTTGGTAGCAGAAAGCTCACACTTTTTGCTACCAAATATATTTTGCTACCAAAATTTTGG TAGCAGAAAGTTCATGCCATTTGCTACCAAATATATTTGGTTACCAAGATTTTAGTAGCAGAAAGCTCGCACTTTTTGCT ACCAAATACCTTTTGCTACCGAAATTTTGGTAGCAAAAATTTCATACTTTTTGCTACCAAATAGATTTTGTTTTGCTACC AAATATATTTGGTAGCAGAAAGGTCACACTTTTTGCTACCAAATATATTTTGCTACCAAAATTTTTAGTAGCAGAAAGCT GACACTTTTGCTACCAAAAACCTTTTGCTACTGAAATTTTTGGTCCCCGAATATCATACATTTTGCTACCAAATACATTT TGTTACCAAAAATTTTTTTGGTAGCAACAACTATTTGCTACCAAAAATTTAGTAACTAATACTTTCTGCTACCCACTTTT TGCTACCAAACTTTTTTGGTAACAAAAACATTTTGCTACCAAAAACAGGACTTTTAGTTACCGAATTTTTGGTAACAAAA AATTCAAATTCTTGTAGTG >DTC_2_3_Mno length=9860;Class=DNA transposons;Order=TIR;superfamily=CMC; CACTACAAGAATAGTGACTTTAAGAGACCAACTCTTTTGCTACCAAAACATTTTTGGTAGCAGAAAACACACTTTTCGCT ACCAAACTTTGGTAACTAAAAGTATCAAGGCTTTAGTTACCAAATTTGGTAGCAAAAACAACACAATCCGCTACCAAATA TAATTTGGTAACAAATAACATGGCGGGAAAAGAATTTTGGTTCCCGCCAAGAGCTTTTTGATACCAAAATAATATTTGGT AACAAAAACATAAGATTCTGCTACCAAAAATTTGGTAGCAAAATATGACTTTTTTGCTACCAAAATGTTTTGGTAACAAA AAGATGGCGGGAAGCAAATTTTTTTCCCGCCCGAGGTATTTGCTACCAAATTATTTTTGGTAGCAAAACATATAACATTT GCTACCAAAATTTTGGTAGCAGAATCATGTTTTCTGTCACCAAAATTTGGTAGCAAAAAATTAAGTTTTTGCTACCAAAA ACATAATTTGTTGCTACCAAATTTTAGTAGCAAAAAATCAAGTTTTTGCTACCAAAAAACATAATTTTTTGCTACCAAAT TTTGGTAGCAGAAAACATGATTCTACTACTAAATTCTTATTTTGGTGACAAAAAGGCGTTTTTTGCTACCAAAAGTTGTG TTTGGTAGCAAAACATATAAAACATTAATATTTATATTTTGTGCTTGTATTTTTTTTTTTCAATTTTCTATGAATATGTC CTATAAGTTTTAACAATCCATCCTAGTGTATTTTGTATAACAATTATTTGATAATTTAATTATTTTGTGTAGGTGTAGCA AGAGACATGTTCATATGTATATATATGTGATATTGTTAACTAAGTATATGTTCCACATAGAATAGTATATAATTTCCTTA TTTGATTGATTTTTAACTTTAAATAATGTATCTCAATTTCAAAACTTTTTTTTTGTTATAATGTTATTAGAACAATGAAT CTTAAATAATTTTTGACATTAAAACCTTATTTTTTAATCTTTAATATATGTCTTTCTGGTACCAAATTCATATTTGGTAG CAAAAAGTATGCTTTCAGCTACCAAAATAATGTTTGGTAACAAAAAATATAANNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACACAC ACACACACACACACACACATCAGTTTCATTAAAAACAAAAAAAAGCCATTCCCCTTCTACCTCAGAAGCTCTGCCGCCCG AAGAAGCCATTTTTCCCCTTCTTCGGAAACACTTCGCCATCTTCGCTCAATGCCAGAAATTCCTCCGCCTTTCTTCATCT CTCTCGCTCCTTCTCTCTAGTCGCTGATTCTCGGCGTCGTAGGCTTCGATTCCCGCTTCCGCCGCCTTCGATTTTCGCTG TCGCCACCGTCGATTGTCGCTGTCGCCGCCGCCGAATGTCGTCGTTGCTGACAAACGCAAGATCACTCCTCTCACTATCA ATGCCTCCTCATTTCCGGTCAGTTTTATCTCCCTCACTTTCCCTTTCTCATCGTGGAAAAGTTTTTATTTTTATAGCATT TTAGGACAAGAATCTGTTTGAATCTGTTTGAATCAGTTTGAATATATTCATCTTAATCAAGCTCAGATCAGGTTTCTATT CATTTCATTTGTTGCTGATTTGGGCTTTTTTGTTTTTTGTCTCTAAGGTTGAATTCGATTATTCTGGTGCATTTAGGGAT ATGGCTAAATATTTGATGGTTGTTCTGATTGAAATATGAATGTGGGCTTTGTGTTCTTTTCTTTTGTTTTGTTTAATTCA AAAAGTTGTATTGACTTTTTCAGGTCGGTAATTAATGGCTTTGGTGAGTATTTGATTTTCGTTTTAGCTGAAATATGAAT GTGGGTTTTATTTTTTTGGTTTGCTTAGGCCTTGGACTTGGGAAGTACGTTTTGGTTTAGATTGGTAGATACTTCATTTT TTTATTTCTAAAGTTGCATTGGCTTATCAATTTTGTTTGATTGTATTTTATGTTGAAATGAGATTGTGGGTTGTTGCGTT GTTATATTTTGGTTGTTGTTCTTTTTGTTTGGTAAGAATCAGGGAATTTAGAAATTTTTGAATCATGATAGTGTATTGGA TATATGCTTTTCTGTTTTGAGTCTGTTTTGAGCCTTTAGGACAAGAATATGTATTGGATATATGCTTTTCTTTTTTCTTT TTTTCTTTGAAGTTGTATTCTTATTTTGACGTTGCTTCCTGGCTTCCTGGCTTTAACATTGATTTCCGGTCATTCGTTTG AAGTTGCTTCCTGGCTTTTCTTAACAGTACGCCTCATGTTTAACAATCCTGCTTTGCTTCTTTTCTGTTTTTGCGCCTGC ATAATTGTTTGTTTGCATTATCTAACTACAACCTGCAGGTTCACACCAATTAGTTTGTTTTAGAAAGAGGGGGAAATTTG GTCAAACATTTGTTTAACATATTTGTATAAGTTATGGCTTTCGAAAATTTGAAAGGAGATGAGCGTCCAAAAGTTTGAAT AATACTATATTGATGATCATTCGGATTAACAGGACATTTGGCAAAGTTGAAAAAAATTGAATATTGACTGTATTATACTA TATTGACGCCTGAAGTGGCAGTTCGCCAGCATACATTTATTTGCATTTAAAATTTATTTGCATTTGTTTAGCCAGCTGAC ATTAGGCACCAACCTTTAATTCGTAGATCTACTATCATGTCAGATATGGATAAGAGTTGGATTTATGTGACGAACCGAAT TTCGGATAATACCCAAAGTCTCAAATCGTTAAGGGGAAAAACTTGTATCTTTGAAAATCTTGAATTCTTGATGGCGAGAT CTACATTGTTGTTTTGTTCTATTTTCGGTTCTGCTACATTAGAGAGGTCATATGCTGTAGTGATGAGAGTGTCTCCTTTT TACCAAGTGTATTTTTAACGTTCATCTTTCTAAGTTGAACCAGTGTTCTTGTTAACGTTCAATATATACATATATGTATA TATATGTTGGTACACTTATTTTAGTTGTATATATGTACCCTTTCCCATGTTATTATCAATTTGGTACGTCTTCTGACAGA AAATGTTTTCCCATCTACATTTCTTACTATCATTCGCTTAATGTAGTTTGCATTTCAATTAACAGGACTACTATCATGTC AGATATGGATAAGAGTTGGATTTATGTGACGAACCGAATTTCGGAGACATATATGGATGGAGTTAGAAGATTTATTGAAC AAGCACGTAATCACCTAGATGCGGATGGAAAATGTCGTTGTCCTTGCAAAAAATGTTTGAATTGTTTTTTCCATCATATA GATATTGTTGAGCGTCATATTTTTGTTAGAGGTTTTAGCTTAAATTATATAAACTGGATTAATCATGGCGAGGAGGAAAC CGATACTACTCCCAATGTACAAGATGAAGACTATGATGCAGAAGGAGAAAAAAGTGACAATGATGACGACATAGATGAGA TGGTAAATGCATTAAATGATGCATTTCCGCACATCAATCCATCTTCAATGGATGATGGTGCAGAAATAAATGATATTGGG GGTTGTGAAGAAGAGACACCGAATTTAGAAGATTTGTTCGCTGAAGCGGAGAGGGAGTTATATAAAGGATGCACAAAGTT TTCCGCATTGACTTTTTTGGTGAAGTTACTTCATATAAAAGTATTGAATCAATGGAGTAACAAGTCTTTTGATATGTTGT TGAAGTTACTTCGGGAGGCATTTCCAGAAGGCTCGAGAATTCCCAAGTCTTATTATGAGGCGAAGCGGATGATGCGGAAG CTTGGGTTGGGATACAAGACTATCCATGTGTGCCCAAAGGAGTGTGTGTTGTATTACAAAGAGTATAAAGATTTGAAAGA CTGTCCAGTATGTGGTCATAAGAGGTATAAAAATTGTAATGCAAAGGAGAAAAAAGTTCCCCATAGAAAAATGCACTACT TTCCTCTCATTCCAAGATTGCAGCGTTTATTTATGTCTCGACACACCGCTGAATATATGAGGTGGCACAAGGAACAACGT TTTGAGACAGAAAGAGTCATTCGACACCCTACTGATGCGGAAGTGTGGAAGGAATTTGACAAACAATATCCGGATTTTGC AGCTGAACCACGTAATGTCAGATTAGGTCTTGCTTCCGATGGTTTCACGCCGTTTGGTGATATGGCAAATCCATATAGTA TGTGGCCAGTTTTAGTGGTGGCTTACAACATGCCCTCTTGGAGATGTATGAAGCAGGCACATATCATGATGTCGACATTA ATTCCGGGACGGAAGGCACCGGGGAAAGACATAGACATTTATTTGAGACCTCTAATTGATGAACTTAAAGAGTTATGGGA GAACGGCGTTAGAACGTACGATGTAGTTGAAAAAAAACAATTTACTTTGCGTGCTGCAATATTATGGACAATTAATGATT TTCCTGCATACGGTACTTTATCCGGCTACTCCACCAAAGGATATGAGGCTTGTCCGGTGTGTATGGATGAAACTGCTTCA TTCCGATTACAAAGTAAGATTTGTTATATGGGGCATCGCCGTTATTTAAGTCCGGATCATGCTTGGCGTTCCGACTTGAA TTTTGATGGTTCTGTTGAAACAAGAATGCCTCCCGAATCAAAAACGGGTGAGGAACTATTGTTAGAGCTAAGCAAGCTGT GGGTTCCTATGCCGGGAAAGGATGTAGCAGTTCGTGAAGCTGACATGAAAAAAATGTCAGAAGCTGGGTACTCAAACGAC AGTAACTGGAAACGGAAAAGTATCTTTTGGGAGCTCGAGTATTGGTCAAAACTTAAGTTGCGTCATAATCTTGATGTAAT GCATATAGAAAAAAATATATGCGATAACTTGGTAGGAACCGTGTTAGGAATAGATGGCAAGTCAAAGGACACCAAAAAAG CTCGCTTGGGCTTACAAGAGTTGAATATAAGAAAGGAGTTGCACTTGGATGGTAAGGGGAAAAAGCCTCCGGCATGTTTT ACATTGTCTACTACGGAGCGGAAAGCTTTTTGTCAATTTTTAAAATCAGTCAAATTTCCCGATGGATATGCAGCAAATTT GTCGCGAAATGTCAACATTAACGATGGTAAGATCACGGGTTTGAAAAGTCATGATTGTCACGTGTTGTTGCAACGATTGT TACCGATAGGATTGCGGCCTTACTTGAAGAAAGACAATGTGTTGGGTCCGATTGCTGAGATGTGTTCATTTTTCCAGCAG CTTTGTGCAAGGACATTGTTAGTAAAGGACTTAGATGCATTACAAGAAGGTATAGTTTACACATTATGTAAACTTGAAAG GATTTTTCCTCCTGCATTCTTTGATGTTATGATCCATCTAGCCTACCATTTACCAGAGGAGGCAAAATTAGCTGGACCAG TGCACACTAGGTGGATGTACCCTTTTGAAAGGTATCACTCTATTTAGTGGATTTATGTATATGTTTAGAGATTTTCCTAA TGACGAACATGTGTACTTTCTCGGGAGTTATATCATAGGACACTAGGGAAATTGAAGAAATATGTCAGAAATAAAGCTCG TCCAGAAGGCTCGATTGCAGAAGGTTATACTATTAGTGAGGTATTGACGTATTGTTCAATGTACATGCGTGACATTGAAA CACAGTTTAATCGGCCCGAACGTAATGCAGACAATATCGAATCCCGACCATCCTCATCAATTTCAGTTTTTCATCAACGT GCGAGACTGTTTGGGAAGCCAAAGGCTATTATGTTGACACAAGATGAACGTGAAAAAGTACGTTGGTATATTCTAAACAA TATTGAAAAGTTGCAGCCATATTTGGAGTAAGATATTGATCCTTATGTGTACCTTCTCAATTCCTTTTTAGAATAACGAA ATTTAACACATAATCATTGACAGTGAACATGTTTCATTATTGCGATCCGAAGGCGTTGATCTTATTAATATTCAGCGTAC CCAAATATCAACCTTTGCAAAGTGGTTTGGAAACAAGGTAAGACAACGCTTGCTTTCATTTGAAATATGAATTTATAGTG AGTGGCGTTCTTCTTAATAACTTACATGAACATTGATGCAGATTAGAGACAAATATGCAGAAGATGATACAACTATCTCT AATGACTTGTATGCTCTGGCAAACGAACCTAACATTTTTGTTCACTCATACCCTGGTTGTATGGTGAATGGAGGGCGATA TCATACTAAAATGCGAGATGACAAGCATACCACACAGAATTCTGGTGTTTACGTTGAGGGAGATTGTGATGGGGTAATAA GTGATTTCTTCGGTGTGATTGAGGAGATTTGGGAGGTGTCATTTTTGTATTGGAATAAGGTGATCTTATTTAAGTGTTCA TGGTTTGATACTGCCAATGGAAGGATGAAGAAAGAGTATAATTTCACCACCATTAAAACTGATTCATTATGCTTTGAGGA TGAACCGTATGTCTTGGTAGATCAAGTGAAACAAATCTATTACATTAATGATGAAAAGAGAGGTGACTCTTGGAAAGTAG TTTAAAAAGTCAATCACCGTCATATATGGGAGAATGTCTCAAAAACAACAGTTGAGGCTTGTCAAGAGGATGAAGAAGAT AACGAGCCTTATCAAGAAGAGTTATCAAATGAGCTTAACATTTCATTTGACACCACAAATGTTAATGAAGCTCCCTTAAA TCGTACGGATATTGGGCCACTCGAAATTGATGATTTCACCATTGATATTTGCATCGATCCCAATGATGAAATTGATGACG AAACAGAAGAGGAAATTGAAACGGAATTCAATGGAGAAGCCGATGATGAAATTGATGGTGACATCGAGAAAACTGATTCT GCAACTGATTATAGTGATTGATTAGGTCAACTTATTTCAGTTTAACTTCAAAATGTGCATTTGTGATTGTTTGAAGTAGT TGTAAAACTGTGACAAGATTTGAATATACCATACCTCCAATCACTAACTTCTATTTTTATTTTTATTATTTCAGGATATC ACTTATGTCTACTCGTAAGAGAAAGCTATCATTTAGTTCTGGTTCAAAATCCAAATCCGCTCCATCTCTGCCGGATGTTG ACGCATCTCCCCGGACTCCTTCAGTGGCATCTTTAGGCACATTAGGCTCATCCACATCTTCGCGAGCAGATAATAAGCCA TCACAAGATTTTCAACAATTTCACGAGGATCAACCTCCGGAGATTCTACGTATTGAAAATACACGTAAGATCATAATAAT TATTTTTAATTGAGTTTTTTTTTACACTATTCTACATTTAACCTCATTTGTAAACAGCACGGTCAACAAATGTTCGAGGA CCAACTACATGTCAAGGAATTAACAAGTTAGTGTCCAAGAAAGGAAAGCTTCAAGTACAATTTAGAGAATCTGAGCTCCG AGTTTACGGGGAGCATGCGGGCCGATTTGCGAGCAAAATTGGTTCTATAGTTCGCCATCATGCTCCATTAAAGTATAGTG GTTGGGGTAAGATTCCTGAAAATGAACAGAATGAATGCATAAGACGATTGAAGGTAAAAATTTCTATTGTAACTTATTCT TTATAACGATTGCACTTATATAAGAATAAATTTAGCAACTTTTTTTTCTTCAGGATCTATTTGATTTAGATTTTGAGGCG CATTCACAATTGAAAGATATTGTACATCAATATTTCTATGAGCGCTTTAAAGGTTATCGATATCGGNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNAAATTATAGGGGAGATGATGTCGAAATTTCTATTATATTTTAATGCATTTAAATGTT TCTTTTTTCATTTATATAGAAAAAAGCACAGGTTGCTGCGGAAAATCATTCCAAAAAGCCAGCAGGTTATTTGGGTGGCT CAAGATCTATAGTTCAACATTTGGAGGAAGTCCATGTAATTAACTTGCACTCACTTAAGTATACTACCACTTGAAACCAT AATTTCTTTTTTCTTTTTAACTAACTAACAAATAATGATTTCTATGTAGAACACACATTCAAGTTCTGACTCAAATGCTT CGGGAAGGTATTTTGAGGTATTCAAGAACACTCATTGGAGCGAATCACGGGGATGGACAACTGAGAGAGCAAAGGAAGAT TATGTAAGAATTACTAAACACTTTATCATTTTGTTTGATTTTATATTTTTTTTACTCTAATTTGAAAGTTTATAACACTT TGCCTAATGCAGGAACAAATGATCAAGATCCGCGATGCTCGTTTAAGTGAAGCACTAGATGGGTAAGAACTTGACTCTGA TGTAGAGGAAGAAATTTACTCTCAAGTTTTGACAAGTAAGAGGTATGAAAAATATGGTTCCAAGCGTGGCATAGGTCCTG TACTAAGAAAAGCGCCACAAGGTCGCAAATCTAGAGGTTTAGGATATGAAAAACTTGAAAATGAAGTTCAGAAAATAAAC GTCGTATGTCGGATATGTAAATCCTAATGAAGCAACAACATAAGCTTATTCAAAAGCTACTTCAACAAATAAATCCGCCG TCCGATCATCCTAGACCTTCCGTCTCAAGAATAGAACATCCTCCGCCACCGCCACCACCGGCCTCAATTTGTTAGAGTGT TTCATTTTTGTAATATTAAGATTTTATTAGTACAATATTTACATAAATGTTTGAGTTTGTTTAAGTATGACTATTTTAGT ATTTTGTTTGGACTCTAATATGTATTGAAATATTTAGAGATTTTTAAATTAATATTTGCTATTTTATTTATATATTTTTT TTTAAAAAATACAGGTATATAAATCTGTCTATTTGCTACTAAATATTTGGTACTTGATTGTTTTGCTACCAAATATATTT TGTTACCAAAATTTTGGTAGCAGAAAGCTCACACTTTTTGCTACCAAATATATTTTGCTACCAAAATTTTGGTAGCAGAA AGTTCATGCCTTTTGCTACCAAATATATTTGGTTACCAAGATTTTGGTAGCAGAAAGCTCGCATTTTTTGCTACCAAATA CCTTTTGCTACCGAAATTTTGGTAGCAAAAATTTCATACTTTTTGCTACCAAATAGATTTTGCTACCAAAATTTTGGTAG CAGAAAGCTCACATTTTTTGCTACCAAAAACCTTTTGCTACCGAAATTTTGGTAGCAAAAACCTCACACGTTTTGCTACC AAATATATTTGGTAGCAGAAAGGTCACACTTTTTGCTACCAAATATATTTTGCTACCAAAATTTTTGGTAGCAGAAAGCT GATACTTTTTGCTACCAAAAACCTTTTGCTGCCGAAATTTTTGGTCCCCGAATATCATATATTTTGCTACCAAATACATT TTGTTACCAAAAATTTTTTTGGTAGCAACAACTATTTGCTACCAAAAATTTGGTAACTAATACTTTCTGCTGCCCACTTT TTGCTACCAAACTTTTTTGGTAACAAAAACATTTTGCTACCAAAAACAGGACTTTTAGTTACCGAATTTTTGGTAACAAA AAATTCAAATTCTTGTAGTG >DTC_2_4_Mno length=9497;Class=DNA transposons;Order=TIR;superfamily=CMC; CACTACAAGAATAGTGACTTTAAGAGACCAACCCTTTTGCTACCAAAATATTTTTGGTAGCAAAAAACACACTTTTTGCT ACCAAACTTTGGTAGCTGAAAATATCAAGGCTTTAGTTATCAAATTTGGTAGCAAAAACAACACAATCCGCTACTAAATA TAATTTGGTAACAAATAACATGTCGGGAAAAGAATTTTGGTTCCTGCCAAGAGCTTTTTGCTACCAAATAATATTTGGTA ACAAAAACATAAGATTCTGTTATAAAAAATTTGGTAGCAAAATATGACTTTCTTGCTACCAAAATGTTTTGGTAACAAAA AGTTGGCGGGAAGCAAATTTTTTTCCCGCCCGAGGTATTTGCTACCAAATTATTTTTGGTAGCAAAACATATAACATTTG CTAGCAAGAATTTGGTAGCATAATCGTGTTTTCTGCCACCAAAATTTGGTAGTAAAAAATTAAGTTTTTGCTACCAAAAG CATAATTTGTTGCTACCAAATTTTAGTAGTAAAAAATCAAGTTTTTGCTATCAAAAAACATAATTTTTTGCTACCAAATT TTGGCAGCAGAAAATATGATTCTGCTACCAAATTCTTATTTTGGTGACAAAAAGGCGTTTTTTGTTACCAAAAATTGTGT TTGGTTCTGTTCTTGATTTCATTGCCGTCCAAGACTCTCGTGGCCTCATTCTTGATTTCTTAAACCATTAATTTCTTAAA CCATTGATTTCATTTCGTTCTGTTCTTAAACCATTGATTTCTTGATTTCATTGCCGTCTGTAGAGTAACGAAAAAACATG GTCCTCCACTTGGGACAATACGTAGTAAGAATGAGAAACAAAAGAACATGGTCCTTCGCTGGGCACTATGCGTTTTTTAG TAGCATGAGTAAAAAAAATGGTCCTCCACTGGGGACTATGCTATTTTAGTGGAACAGTAATAATGAGATAACAAAAAAAC ATTGTCCTCCACTGGGGACTATTCTTTTTTAGTAGCATAATAAGAATGGGTGATAAAAAATGGAAGAGTTATGCTAAATA CAAACTCTTTACAGATTCTACTAATAAAGCAAGTTACGAGCCGGTGAACGGAGAGAGAGGCCAGTAAACGGAGCCGGGGA ACCTGCTTCGAACGGCGAGGAGAGGAGAGGAACAAAGAAAAATTTCCGGATAAGTGCTTTTTCTCTCCTAAAAGCAATAC CAAACCCACCCTATATATATGTGATATTGTTAACTAAGTATATGTTCCACATAGAATAGTATATAATTTCCTTATTTGAT TGATTTTTAACTTTGAATAATGTATCTCAATTTCAAAACTATATTTTTTTGTTATAATGTTATTAGAACAATGATTCTTA AATCATTTTTGACATTAAAACGTTATTTTTTTAATCTTTAATATATGTCTTTCTGGTACCAAATTCATATTTGGTAGCAA AAAGTATACTTTCAGCTACCAAAATAATGTTTGGTAACAAAAAATATAAGTTTCTGGTACCAAATTTTGGTAGCAGAAAA CATGATTCTGCTACCAAATTGTTATATTGGTGGCAAAAAGAAATTTTTTGCTACCAAAAGAACCAAAAGATTTTTTTGGT AACAAAATAAAGAACGAAATTTTGGTGGGAAAATCAATTTAACCTTAAAAATTAAACACACACACATCAATTTCATTAAA ACAAAAAAAGCCCTTCCCCTTCTGCCTCAGAAACTCGGCCGCCCGAAGAAGCCCTTCTTCCCCTTCTTCGGAAACACTTC GCCATCTTCGCATCTCTGCCAGAAATTCCTCCGCCTTTCTTCCTCTCTCTCGCTCCTTCTCTCTCTAGCCGCTGATTCTC AGCGTTGTAGGCTCCGATTCCCGCTTCCGCCGCCTTCGATTGTCGTTGTTGCCGCCGCCGATTGTCGCTGTCGTCGCCGC CGATTGTCGTCGTTGCCGACAAACCCAAGATCTCTCCCCTCACCATCAACGCCTCCTCATTTCTGGTCAATTTTATCTCC CTTTTCCCTTTCTCATCGTGGAAAAGTTTTTATTTTTATAGCATTTTAGGACAAGAATATGTTTGAATCAGTTTGAATCT ATTTTGAGCCTTTAGGACAAGAATCTGTATTGGATATATGCTTTTCTTTTTTTCTTTGAAGTTGTATTCTTATTTTGACA TTGCTTCCTGGCTTCATGGCTTTGACATTGATTTCCAGTCATTCGGATTAAGTTGCTTCCTGGCTTTTCTTAAGTTGATT TCCGGTCATTCGGATTAACAGGACATTTGGCAAAGTTGAAAAAAATTGACTATTGACTGTATTATACTATATTAACGCCT GAAGTGGCAGTTCACCGGTAGACATTTGTTTGCATTTAAAATTTATTTGCATTTGTTTAGCCAGCAGACATTAGGCACCA ACCTTTAATTCGTTGATCTACTACCATGTCAGATATGGATAAGAGTTGGATTTATGTGACGAACCGACTTTCAGAGACAT ATATGGATGGAGTTAGAAGATTTATTGAACAAGCACATAATCACCTAGATGCGGATGGAAAATGTTGTTGTCCTTGCAAA AAATGTTTGAATTGTTTTTTCCATCATATAGATATTGTTGAGCGTCATATTTTTGTTAGAGGTTTTAGCTTAAATTATAT AAACTGGATTAATCATGGCGAGGAGGAAACCGATACTACTCCCAATGTACAAGATGAAGACTATGATGCAGAAGGAGAAA AAAGTGACAATGATGACGACAAAGATGAGATGGTGGATGCATTAAATGATGCATTTTCGCACGTCAATCCATCTTCAATG GATGATGGTGCAGAAATAAATGATATTGGGGGCTGCGAAGAAGAGACACCTAATTTAGAAGATTTGTTCGCTGAAGCGGA GAGGGAGTTAAATAAAGGATGCACAAAGTTTTCCGCATTGACTTTTTTTGGTGAAGTTACTTCATATAAAAGTATTGAAT CAATGGAGTAACAAGTCTTTTGATATGTTGTTGAAGTTACTTCGGGAGGCATTTCCAGAAGGCTCAAGAATTCCCAAGTC TTATTATGAGGCGAAGCGGATGATATGGAAGCTTGGGTTGGGATACAAGACTATCCATGTGTGCCCGAAGGAGTGTGTGT TGTATTACAAAGAGTACAAAGATTTGAAGGAATGTCCGGTATGTGGTCATAAGAGGTATAAAAATTGTAATGCAAAGGAG AAAAAAAGTTCCCCATAGAAAAATGCACTACTTTCCTCTCATTCCAAGATTGCAGCGTTTATTTATGTCTCGACACACCG CTGAATATATGAGGTGGCACAAGAAACAACGTGTTGAGACGGAAGGAGTCCTTCGACACCCTGCTGATGCGGAAGCGTGG AAGGAATTTGACAAATAATATCTGAATTTTACAGCTGAACCACGTAATGTCAGATTAGGTCTTGCTTCCGATGGTTTCAC GCCGTTTGGAGATATGGCAAATCCATATAGTATGTGGCCAGTTTTACTGGTGGCTTACAACATGCCCTCTTGGAGATGTA TGAAGCAGGCACATATCATGATGTCGACATTAATTCCGGGACGGAAGGCACCGGGGAAAGACATAGACATTTATTGGAGA CCTCTAATTGATGAACTTAAAGAGTTATGGGAGAACGGCGTTAGAACATACAACGTAGTTGAAAAAAAACAATTTACTTT GCGTGTTGTAATATTATGGACAATTAATGATTTTCCTGCATACGGTACTTTATCCGGCTACTCCACCAAAGGATATAAGG CTTGTCCAGTGTGTGTGGATGAAACCGCTTCATTCCGATTACAGAGTAAGATTTGTAATATAGGGCATCGCCGTTATTTA AGTTTGGATTATGCTTGGCGTTCCGGCTTGAATTTTGATGGTTCTGTTGAAATAAGAATGCCTCCCGAATCAAAAACGGG TGAGGAACTATTGTTAGAGCTAAGCAAGCTGTGGGTTCCTATGCCGGGAAAGGATGTAGCAGTTCGTGAAGCTGACATGA ACGAAATTTAACACATAATCATTGACAGTGAACATGTTTCATTATTGCGATCTGAAGGCATTGATCTTATTGATATTCAG CATACCCAAATATGATCCTTTGCAAAGTGGTTTGGAAATAAGGTAAGACAACGCTTGCTTTCGTTTGAAATATGAATTTA TAGTGAATGGCGTTCTTCTTAATATCTTACATCAACATTGGTGCAGATTAGAGACAAATATGCAGAAGATGATACAACTA TCTCTGATGACTTGTATGCTCTGGCAAACGAGCGTAACATTTTTGTTCACTCATATCCTGGTTGTATGGTGAATGGAGTA CGATATCATACTAAAATGCGAGATGACAAGCATACCACACAGAATTCTGGTGTTTACGTTGAGGGAGATTGTGATGGGGT AATAAGTGATTTCTTTGGTGTGATTGAGGAGATTTGGGAGGTGTCATTTTTGTATTGGAATAAGGTGATCTTATTTAAGT GTTCATGGTTTGATACTACCAATGGAAGGATGAAGAAAGAGTATAATTTCACCACCATTAAAACTGATTCATTATGCTTT GAGGATGAACCGTACGTCTTGGTAGATCAAGTGAAACAAGTCTATTACATTAATGATGAAAAGAGAGGTGACTCTTGGAA AATAGTTCAAAAAGTCAATCACCGTCATATATGGGAGAATCTCTCAAAAACAACAGTTGAGGCTTGTCAAGAGGATGAAG AAGATAACGAGCCTTATCAATAAGAGTTGTCAAATGAGGTTGATGTTGGGAATGGTGTCCTAGAAGCATGAGATATAATA GGATATTTATTATTTATTTAATAAAATAGTTTATTCATTATTTTATGTGCATATATTTATGAATATTTTGTGAATATCAA TGAACATTTCATGATTATTTATGTAACCTTAAACACTGTATATAAGTGTTATATACGAGAGGATAATGTTTAAGGATAAT AATCAAAAATCAATGTTCATAATGAATTTAATTAAAGTTCGGAATCTTTAATTAAAACATTATTAATACATGTCATTCCC ATTTAGAATGGAATGGTGTTATCCGCACTGTTAATATGATGAGATATTGAATGAGTGTATTTCGCATAATGAGATTATGT GGAACAAGGACACAGACACAATATGAATTTCTAATAATTTCCGTTAAGTATAGAAATTCTAATTGAGTCTACCGATGGTC ATATATAGAATGATCTTAATCCTGAGTTCTTAACAAACTCCTATTTATGGATTTGTGTCTTTTGATTTACTCGGTACAGA TTCTGAGATCCTGAATCCTATTCCTTGTATTTTGGAGACATGATGAAGTAGGTAGCCGGGAATGTTATTACACGAGATGG AATCCATTCCTTCTTAAGAAAGAAGTAGATAAATAATTCTCTTGAGGGTTGATTCGGTACTTGGACCAGTAGGAGCTCCG ATTCATGAATGTGTTTTATGAATCACTATCCATTAGAGAATCAATGGTACTCAAGGATAAAGAAGTAATTAGAGAGGTTA ACGGATTTTACCTTGCTCTAATTATGAATTATTTATGGAGGATTGATCTATATGCAATGACTATATCAAATGGACACTTC ACAGTTTAGAAGTAATTAATATCTATAATTTCGAGAGTGCAATTCCAAGTTTATAGTGGAGTAACTATTGGAATTAATAG ACTTAATTAATTAATTAAAGTGTTTAATTAATTATTAATTTTATTGGAGCTCGGAATTATAGGTCCATTAGTCCCCGCGT CGTCCAAGTAATTCTGCCAGACACAGAGGGCAAAATGGGAATTTTAGAATTATGGAATTCTAAAATTAAATACTCGAAAA TAATTAATTGAGAATTAATTATTATTTAAATAATGTGATTATTTAAATTTGAATTTGAACACATCTAGATTTATCCATTT AAACTTATTTGATAAGTTGTTCAATTTAGAATTCAAATTAATTTAAGTTTGACTTAAATTGGAATTTGAATTTGAGTCAA AATTGGACTACAGGATAAATGACGATTTTCTCTTCCTTCCCTATCTGATATTGGCGCCACACAGGGATGAGAATCCCCTT AGAATGGCCGGCCATATAGGATAGAGGAAAAGAGGAGATTTGGTTTAAAATTCAAATAGGACATAATTAACAAGCTTTAT CTTAGAGATAGAGATTAGATTCCTTCTAGAAGTTTGACTTCTACTCTATAAATACTATTTTTGAGACAATTTTCGGAATG GTTTTTTGCCCTAATTTTAGAGGTAGCCGAAATTTCTCTATAGAAATTTTGGAAACAATTTTTCATCCCTAAGGGTTAAG GCTGGCCGAAATTTAAAAGAGAGAAAGGAAGGAAAAATTTTTCTCCAAAAATTCCACATCGTGCATGTGATGGTGTTTGT AGAAATTTGAGTGTTTATTGTAACCCGTTTTGTCTCATGTGTGCCCACACACACGTCTTCGTGGATTCTAGGAATTGATG TGGAAGACATTGGTTTTCTAAACACAAAGATTGGAGCAAGGACTGTTCGTGGTCAAAGAACTCAAGTTATCATCCGAGTC GGCTTCCAGGGATTTTTCTTGTTTGAGTTATTGATATATATAAGTTAATGAGATTAATTTATTCGTGCATAAATTAATAT AATCTATAGAGTATCTCAAAAGTTTTATGAAAATTTTTGTTATACACGATCCGCCTCTTTCCCGCACCACCGCGCTTCCG CATCCGGATTCGATCCGGAGACCAACAGTTGACATTTCATTTGACACGACAAATGTTAACGAAGCTCCCTTAAATCGTAC GGATATTGGGCCACTCGAAATTGATAGTTTCACCATTGATATCTGGATCGATCCCAATGACAAAATCGATGACGAAACAG AAGAAGAAATTGAAACGGAATTCAATGGAGAAGCCAATGATGAAATTGATGGTGACACCAAGAAAACTGATTCCGTAACT GATTATAGTGATTGATTAGGTCAAATTATTTCAGTTTAACTTCAAAATGTGCATTTGTGATTGTTTGAAGTAGTTGTAAA ACTGTGACAAGTTTGAATATACCATACCTCCAATCACTAACTTCTATTTTTATTTTTATTGTGTCAGGATATCAGTTATG TCTCCTCGTAAGAGAAAGCTATCATTTAGTTCTGGTTCAAAATCCAAATCCGCTCTATCTCTGCCGGATGTTGACGCATC TCCCCAGACTCCTTCAGTGGCATCTTTAGGCACATTAGGCTCATCCACATCTTCACGAGCAGATAATGAGCCATCGCAAG ATTTTCAACAATTTCATGAGGATTAACCTCCGAAGATTCTACGTATTGAAAATACACGTAAGATCATAATAATTATTTTT AATTGAGTTTTTTTTTTTTACACTATTCTACATTTAACCTCCTTTGTAAACAGCACAGTCAACAAATGTTCGAGGACCAA CTACATGTTAAGGAATTAACAAGTTAGTGTCCAAGAAAGGAAAGCTTGAAGTACAATTTAGAGAATCTGAGCTCCGAGTT TACAGGGAGCATGCGGGCCGATTTGCGAGCAAAATCGGCTCTATAGTTCACCATCATGCTCTATTAAAGAATAGTGGTTG GGGTAAGATTCCTGAAAACGAACAGAATGAATGCATAAGACTATTGAAGGTAAAATTTTCTATTGTAACTTATTCTTTAT AACAATTGCACTTATATAAGAACAAATTTAGCAACTTTTTTTTCTTCAGGATCTATTTGATTTAGATTTTGAGGCGCATC CACAATTGAAAAACATTGTACATCAATATTTCTATGAGCGCTTTAAAGGTTATCGATATCGGTGCCACTAAAAATATCAG GCCATTATTGAGGAAGGAAAAGATCCATTGCAACATTTACGAATCAATACATTAAACTAGATGATTGGGAGTGGATGTGC ACCAATTGCTTTGGCGATGATCAATGGTAGGTAAAATGAACAACTTAACTGTATTATGAGATGTTTGTTTGAGAATGTGG TTTTGGATATGCAAATCGAACCAATATATGTGGTTTTAGATTTTCTAGGTTAATTGAAATTATAGGGGAGATGATGTCAA AATTTCTATTATATTTTAATGTATTTAAATGTTTCCTTTTTCATTTATATAGAAAAAAGCACAAGTTGCTGCGGAAAATC ATTCCAAAAAGCAAGCAGGTTATTTGGGTGGCTCAAGATCTATAGTTTAACATTTGGAGGAAGTCCATGTAATTAACTTG CACTCACTTAAGTATACTACCACTTGAAACCATAATTTCTTTTTTCTTTTTAACTAACTAACAAATAATGATTTCTATGT ATAACACACATTCAAGTTCTGACTCAAATGCTTCAAGAAGGTATTTTGAGGTCTTCAAGAACACTCATTGGAGCGAATCA CAGAGGTTTAGGATATGAGAAACTTGAAAATGAAGTTCAGGAAAATAAACGTCATATGTCGGATATGGAAATCCTAATGC AGCAACAGCAAGAGCTTATTCAAAAGCTACTTCAACAAATAAATCCGCCGTCCGATCATCCTCAACCTTCCGTCCCAAGA ATAGAAGATCCTTCGCCACCGCCGCCACCGGCCTCAATTTGTTAGAGTGTTTCATTTTTGTAATACTAAGATTTTATTAG TACAATATTTACATAAATGTTTGGGTTTGTTTAAGTATGACTATTTTAGTATTTTGTTTGGATTCTAATATGTATTGAAA TATTTAGAGATTTTTAAATTAATATTTGATATTTTATTTATATATTTTTTCAAAAAATAGAGGTACATAAATCTGTCTAT TTGCTACTAAATATTTGGTACTTGATTCTTTTTGCTACCAAATATATTTTGTTACCAAAATTTTGGTAGCAGAAAGCTCA CACTTTTTACTACCAAATATATTTTGCTACCAAAATTTTGGTAGCAGAAAGTTCATACCTTTTGCTACCAAATATATTTG GTTACCAAAATTTTGGTAGCAGAAAGCTCGCACTTTTTGCTACCAAATACCTTTTGCTACTGAAATTTTAGTAGCAAAAA CCTCACACTTTTTGCTACCAAATATATTTGGTAGCAGAAAGGTCACACTTTTTGCTACCAAAATATATTTTGCTACCAAA ATTTTTGGTGGCAGAAAGCTCACACTTTTTGCTACCAAATATATTTGGTAGCAGAAAGGTCACACTTTTTGCTACCAAAA TATATTTTGCTACCAAAATTTTTGGTAGCAGAAAGCTCACACTTTTTGCTACCAAAAACCTTTTGCTACCGAAATTTTTG ATCCCCGAATATCATACATTTTGCTACCAAATACATTTTGTTACCAAAACTTTTTTTGGTAGTAAAAACTATTTGCTACC AAAAATTTAGTAACTAATACTTTCTGCTACCCACTTTTTGCTATCAAACTTTTTTGGTAACAAAAACATTTTGCTACCAA AAACAAGACTTTTCGTTACCGAATTTTTGGTAACAAAAAATTCAAATTCTTGTAGTG >DTC_2_5_Mno length=7683;Class=DNA transposons;Order=TIR;superfamily=CMC; CACTACAAGAATAATCACTTTAAGAGACCAAATTTTTGATGCAAAAAAATTTTTCGTAGCAAAAAACGCACTTTTTGCTA CCAAACTTTAGTAGCTTAAATTATCAAGGCTTTTTAGTTACCAAATTTGGTAGTAAAATCAACACAATCCACTACCAAAT ATAATTTGGTAAAAAATAAGATGCGGGAAATGAAATTTGGTTCCTGCCAATAGTTTTTTGCTACCAAAACAATATTTGGT AACAAAAGCATAAGATTTTACCACCAAAATTTGGTAGCAAAATATTATTTTTTTTGTTACCAAACATATTTTAGTAACAA AATGTTGGCGGGAAGCAAAATTTTTTCCCGCCCAAGGTATTTGCTACCGAATTATTTTTGGTAGCAAAATAAATAACTTT TGCTACCAAGTGTTGGAAGTAAAATATAACTATCTGCCACCAAAATTTGGTAGCGAAAAATTAAGTTTTTGCTACCGAAA AACATAATTTTTTGCTACCAAATTTTGGTAGCAGAAAATAAAATTTTGCTACTAAATTCATATTTTGGTTGCAAAAAGAT GTTTTTTTCTACCAAAAGTTGTGGTTGGTAGCAAATCATATAAAAACTTTAAAATTTATATTTTGTGCTTGTCTTGTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCTAGTTTTCTATGAATATGTCTTATATTAAGTTTTAACAATCATCCTA GTATATTTTGTATAATAATTATTTTGTAATTTAGTTATTTTGTGTAGGTGTAATAAGAGACATGTTCATGTGTACACATA TGCGATCTTGTTAATTAAGTATATGTTCCACATATAGTAGTATATAATCTCGCTATGTTTGGTAACAAAAAAATAAGTTT ATGGTACCAAATTTTGGTAGCTGAAAACATGATTCTGCTGCCAAATTCTTATTTTGGTGACAAAAATGCGTTTTTGCTAC CAAAAGTTGTGTTTGGTAGCAAATTATATAAAACTTTAAAACTTATATTTTGTGCATGTATTGTTTTTTTTTTTGTTTTC CATAAATATGTCATATATTAAGTTTTAACAATCATCCTAGTATATTGTGTATAACAATTATTTGATAATTTAATTATTTT GTGTAGGTGTAACAAGAGACATGTTCATGTGTATATATATGTGATATTATTAATTAAGTTTATGTTCCACATAGAGTAAT ATATAATCTTGCTATTTCAAAACTATATTTTTTGTTATAATGTTACTAGAACAATGAGTCTAAAATAATATTTGTCATCA AAAAGTGTTTTTTTTTATAAATTTTTTAATGTCTTTTTGCTACCAAATTAAATTTTAGTAGCAAAAAATATGCTTTTGAC TACCAAAATAATGTTTGGTAACAAAAAACATAATTTTCTGGTACTAAATTTTGGTAGTAGAAAATATAATTATGCTACCA AATTCATATTTTGGTGACAAAAAGAAATTTTTTGCTACCAAAGGAACAAAAATATGTTTTTGGTAACAAAAAAAGAACAA AATTTTTGTGGGAAAATCATTTTAGGGTCTGTTTAGTTCGCTGATTCGAGTTTTTAATTCGAGTTGAGATGTGACTTTAT GTAAGAACTTTTTATTGTAGTTATAAAATTAGATGTGATTGTTTATGAGAGTTTTTTACTGTAGTAAAACTCGAATCATG AACGGGACCTTAACCTACCATACCTAAAAATTAGAAACACACCCACGCACGCATCAGTTTCATTAAAAAGCAAAAACTCA TCGTCGCCTTCTTCCCCTTCTTTAGAAACTCGTCGTCGCCCTTCTTCCCCTTCTTCAGAAACTCGTTGCCATCTTCTTCA AAAATTCCTCCGCCTTTCTTCCTCTTTCTCGCTCCTCTCTCTAGCTGCTGATTCTTGGCGTTGTAGACTCTGATACCTGC TTCCGCCGCCTTCGATTGTCGCTGTCGCCACCTTTGATTGTCGTTGTTACTGCCGCCGATTCTCGTCGTCGCCGCCTAGT TGCTGACAAACCCAAGATCTCTCTCCTCACCATCAACACCTCGTCATTTCCGTCAGTTCTATCTCTCTCTTTCCCTCTCT CATCGTGGAAAAGTTTTTATTTTTATAGCATTTTAATTGTATCACTAGCAGACATTTAGACCAAGATCCCCAGTTCTTTT TTTTTTTCATAAATTAGCATGCAGCCTGTGGTAATACACAAACACAAACGCGAAAAAAGGGACTATATGTTCAATACATT GATTTCCAACCCATAGAAAAACTAACCAGCCCTACAGCCGCAGAAACAAGAAATTTGACCCAGTCCATTGGAGTTAAACT AGGATTTTTCTTTTCTGGCTGTCAAAATTTAGACCAGGATCCCCAGTCTTTGAGATAATTATGATATCACTCGCAGACAT TTAGACCAAGATCCCCAGTTCTTTTTTTTTTTCATAAATTAGCATGCAGCCTGTGGTAATACACAAACACAAACGCGAAA AAAGGGACTATATGTTCAATACATTGATTTCCAACCCATAGAAAAACTAACCAGCCCTACAGCCGCAGAAACAAGAAATT TGACCCAGTCCATTGGAGTTAAACTAGGATTTTTCTTTTCTGGCTGTCAAAAAGGGAAAAAAGAAATATTGCATTACCAG TCAATAGTCAAAATTGAGCTCTGATAAGCAGTTGGATAGTAATTTAAATATCCTTAAGGCATTGACACATGCATTTAGAC CTAGTTGGCAACATCACTGACGGCAGACTAGAAAATAGTTCTAGCCCTTGGCAATACACTGCTGATATGGTTCTGTAAAA CATCAACTAATTACCAAAAACCAGGACAAAAGCACTAAGAGCCATCAAAACAATAAGCCATAAAAGTAAAATCATCAGCA TAATGTAGTGACATATTGGTAACATCGCTAAATGACAGACTTAAAAACAGTTCTAGCCCTTGGCAATACAATGGTAATAC GTTTTTGAAATTCTTTCTTCACAAACTTCAACTAATAACCCCAAAAGCAGGAGAAAAGTTCTCAGAGCCATCAAAACAAT AAATAAACAATAAAAAAGAAGAAAAAGGGCCACTTCTTGTCATGATCACTAATTAACTGAAGAGAATTGTAAACCAAACA AGAGATAAAAAGATTTAAATTAATCACTTCTAAACTAACATGTGATCATGAGAATCTATGAGATTTAAATTCGAATTTCA CAATGCTAGATAAGCTCAAGGATACATCATATACAAAGCAAGAACAAAAGGAAGTGCATAAAGGAGAGAAAAAGTGTGTG AGATTAAAGGAAATATCATTATCAATAAATTTTCTTGCTTTCTTCTTTTATCTTCTCTTATCCTTCTTATCCTAATAAAC TTCAACGTGGTTTGTTTACTTAACAGCTCAACCTAGACATTTGCATCTTTTATGCTACTTGCTAAACTCAAGAAAGCCTA AAATTCATTTTTGTTAAAAAAAAAAAAAAAGGAAAAGCAAAAAGAGCTGCCCTAGACAAGTGATCATCACGTAAGTAAAA AAGCATGCCAAAATGCCTCCAATTAATACTTTAGAGGAAAGAAAGCTGTATTACTATCTGCCCTGAATCAGGGTACACAA GAAATACAATTAGCATTGAGCAGAACAATAAAACATGGGACAAAGCCAAGCAGAATAATCCAGATGTGGGAGGATTCATA CAACATTATACTTCATACAGCATCAATTGAGTTCAGGTTTAACAAGTTACAACATTTGATCGATACAAATTTTCCACATA ATAAAAGTTATTACTTTAAGCCTTTTAGCACGAATCTTCTTCAAGTTTCTTCGCATTACATTTATATGATCATGCAAAAA CCTTTTTTGGATCATGTCCTTGAGAAGCTTGAGAGCAAGAATGCATGAAAGACAGGTAATTAGAGAACTGAATTTTTGAA AACCATGAACATGATCAATCAAAAAGTTTCCACTTAAAACCTCATGAGTTTCATTTTCTCTATACGAATCCCTTGCACAA CTGAGTTTGAACAAACAACTTGGTATAATTATTTGATTCTAGTCATATTTGATATTTGTTTGTATTTGTTTAGCCGGTAG ACATTAGGCACCAACCTTTAATTTGTTTTGACTTCAAAGTTTCAATGATCATACTTGTAGATCTACTACCATGTCAGATA TGGATAAGAGTTGGATTTATGTGACGAACCGACTTTCGGAGACATAAATGAGTGGAGTGAGAAGATTTATTGAACAAGCA CGTAATCACCTAGATGTACAAGATGAAGAGTATGACGCAGAAGGAGAAAAAAGTGACAATGATGACGACAGAGATGAGAT GGTGGATGCATTAAATGATGCATTTCCGCACGTCAACCATCTTCAATGGCTGATGGTACGGAAATAAATGATATTGGGGG CTGCGAAGAAGAGACACCTAATTTAGAAGATTTGTTCGTTGAAGTGAAGAGGGAGTTATATAGAAGATGCACAAAGTTCT TCGCATTGACTTTTTTTAGTGAAGTTACTTCATATAAAAGTATTGAATCAATGGAGTAACAAGTCTTTTGATATGTTGTT GAAGTTACTTTGGGAGGCATTTTCAGAAGATTCGAGAATTCTCGAGTCTTATTATGAGGTGAAGCGGATGATGTGAAAGC TTGGGTTGGGATACAATACCATCCATATGTGTCAAAATGAGTGTGTGTTCTATTACAAAGAGTACAAAGATTTGAAGGAA TGTCCAATATGTGGTCATAAGAGGTATAAAAATTGTAATGCAAAGGAGAAAAAAGTTCCACACAGAAAAATGCACTACTT TCCTCTCATTCTAAGATTGCATCGTTTATTTACGTCTCGACACATCGCTGAATATATGAGGTGGCACAAGGAACAACACG TTGAGACGGAAGGAGTCCTTCGACACCCTGCTGATGCCGAAGTGTGGAAGAAATTTGACAAACAATATCCGGATTTTACA GTTGAATTGCGTAATGTCAGATTAGGTCTTGCTTCTGATGGTTTCACGCCATTTGGAGATATGGAAAATCCATATAGTAT GTGGCCAGTTTTACTGGTGGTTTACAACATGCCCTCTTGGAGATGTATGAACCAAACACATATCATGATGTCGACATTAA TTTCGGGACGGAAGGCACCGAGAAAAGACAGACATTTATTTGAGACCTCTAATTAATGAACTTAAAGAGTTATGGGAGAA CGGCGTTAGAATGTACGATGTAGTTGAATAAAAAATAATTTACTTTGCGTGCTGCAGTATTATGGACAATTCATGATTTT CCTGCATATGGTACTTTATCCGGGTACTCCACCAAAGGATATGAGGCTTGTCCAGTGTGTATGGATGAAACTGCTTCATT CTGATTACAGAGTAAGATTTGTTATATAGGGCATCGCCGTTATTTAAGTCCAGATCATGCTTGATGTTCCGACATGAATT TTGATGGTTCTGTTTAAACTAGAATGCCTCCCGAATCAATATCGGGTGATGAACTATTGTTAGAGCTGGACAAGGTGTGG GTTCCTATGCCGGGAAAGGATGTAGCAGTTCGTGAAGCTGACATGAAAAAAATATTTGAAGCTGGGTACTTAAACGACAG TAACTGAAAACGAAAAAGTATCTTTTGGGAGCTCGAGTATTGGTCGAAACTTAAGTTGCATCATAATCTTGATGTAATAG ATATACAAAAAAATTTATGCGATAACTTGGTGGGAACCGTGTTGGGAAAGGACACCAAAAAAGCTTGTTTGGGTTTACAT GAGTTGAATATAAGAAAAGAGTTGCACTTGGGTGGTAAGGGGAAAAAGCCTCTAGCATGTTTTACATTGTCTACTATGGA GTGGAAAGCTTTTTGTCAATTTTTGAAATCAGTCAACTTTCCTGATGGATATGCAACAAATTTGTCCCGAAACGTCAACA TTAACGATGGTAAAATCTTGGGGTTGAAAAGTCATGATTGTCACGTGTTGTTGCAACGACTGTTGCCGATAGGATTGTGG CCTTACTTGAAAGACAATGTGTTGGGTCTGATTGCTAAGATGTGTTCATTTTTCCAGCAGCTTTGTGCAAGGACATTATT AGTAAATGACTTAGATGCACTATAAGAAGGTATAGTTTACACATTATGTAAACTTGAGAGGATTTTTCCTCCTGCATTCT TCGATGTTATGATCCATCTAGCCTACCATTTACCAGAGGAGGCAAAATTAGCTGGACCAGTACATACTAGGTGGATGTAC CCTTTTAAAAGGTATCACTCTATTTAGTGGATTTACGTATATGTCTAAAGATTTTCCTAAATAAGAACAAGGGTAATTCT CTTAAGTTATATCATAGGACACTAGGGAAATTGAAGAAATATGTCATAAATAAAGCTCATCTAGAAGGCTCGATTGTAGA AGGTTATACTATTAGTGAGGCATTGATGTATTGTTCAATGTACATGCGCGACATTGAAACATGGTTTAATCGCCCCGAAT GTAATGCAGACAGTGTCGAAGCCCGACCATCCTCATCAATTTCAGTTTTTCATCAACGTACGAGAATATTTGGGAAGCCA AAGTCTATTATGTTGACTCAAGATGAACGTGAAAAAGTGTGTTTGTATATTCTAAACAATACCGAAAAGTTGCAGCCATA TTTGGAGTACGATGTTGATCCTTATGTGTACCTTCTCATTTCCTTTTAGAATAACAAATTTTAACTGGTAATCACTGACA TCGTACATATTTCATTATTGCGATCACAAGGCGTTGATCTTATTGATATTTTGCGCACCCAAATATCATACTTTGCAAAG TGGTTTGGAAATAAGGTAAGACAATGCCTGCTTTTGTTTGAAATATGAATTTATGGTGAATGAAGTTCTTTTTAATATCT TACGTCAACATTATTGCAGATTAGGGACAAATATGCATAAGATGATACAACTATCTCTGATGATTTGTATGCTATGGCAA ACGAACCCAACATTTTTGCTCACTCATATCCTGGTTGTATGGTGAATGGAGTGCGATATCATGCTAAAATGCGAGATGAC ATGCATACCACACAGAATTCTGATGTTTACGTTGAGGGAGATTGTGATAGGGTAATAAGTGATTTCTTCGGTGTGATTGA GGAGATTTGGGAGGTGTCATTTTTGTATTGGAATAAGGTGATCTTATTTAAGTGTTCATGGTTTGACACTGCCAATGGAA GGATGAAGAAAGCGTATAATTTCACCACCATTAAAACTGATTCATTATGCTTTGAGGATGAACCGTATGTATTGATAGAT CAAGTGAAATAAGTCTATTACATTAATGATGAAAAGAGAGATAACACTTGGAAAGTAGTTTAAAAAGTCAATCACCGTCA TATATAGGAGAATGTCTCAAAAACAATAACTGAGGCTTATCAAGAGGATGATGAAGATAATGAGCCTTATCAAGAATAGT TATCAAATGAGGTTGACATTTCATTTGACACCACAAATGTTACTATTAGAATTTTACTTATCAAGAATAGTCTCAAAAAT TTTTGGTAGCAAAAACTATTTACTATTAGAATTTTAGTAACTAATACTTTCTGGTACGCACTTTTTGCTAGCAAAATTTT TTGGTAATAAAAACATTTTGCTACCAAAAATAGGGCTTTGGTTACCAAATTTTTAGTAACAAAAAATTCAAATTCTTGTA GTG >DTC_2_6_Mno length=6715;Class=DNA transposons;Order=TIR;superfamily=CMC; CACTATTTATTCAGAGTTTTCTAACCAACACTTTTATACAAGTGTATACGTAGCCTCTGATATTTATATTTTATGTGCAA TTGTTCTTAATTTTCATTATTATATTTGCATACTAACCTTTTTAAATATCTAATATTGTTCCTGCAATATTTAAATTCTT AAGTTTAATATCATTATTACTATCTATTTAAATTCTTAAATTTAATATTATTTTACTATCTGTTGGTTAATTTTGGTTAA TTATTATATATCTTGTATATGTAGAAATATTAAATTAAAAATTTTTATGTGCATCTCTATCTCACTTGATGCTTGTTAAG GTTAAATTTAGTTCCTCATTTCTCACTGTACATGTGTCATCATGCATTTCGGAGAATGTGATCAAATTATGAAATTGCCA GCCAAAACAGGCTTTGAGCAGTCGATCAATCCAACAGGCTTCGAGCAGTCAATCAATCCAACAACTTGCCAGACGAGCAG TCAAACAGACATGCCAGCTCAGCATTTGAGAATTAAATATGAAGATCTTATCTGCAACAAGAGTATTTGGTATTAAACTA AAGGATCACATCCAGAAAAGTAAAGGGGAAAGTTAATCATCCCACACGATTGCTCCCTTAGCGTCATCCTTATAAGAAAA GATTTCCTAGAGGAACATCAATAAAAAGTCAAACGAGAAACTACCCAAAGGCTTATTTTCAGCCACCAAGAGCCTATGAA TGCATGCCATAGGCGTCTAAGACAAGGGTTCACGTATTCCTACACACGCTTTCACCCCTATAAGCATATTTTCTCTCTTT TCAGGTACTTTTTAGTATTTTTCTCACATTGTTTCTCTTTGTATTCATGGAGAGCACTATTGTACTCATCTTCTTCAGTC ATAGTGAAACTACCGAAGACCCTACAGTGGACGTACCTTGTGTTAGCGTTTATGCCCTTAAGAATAAATGTAACAATATT CTTTGAGATATTTTGACTATTAATAAAGATTTGTTTATTTTATATATCTATGAATTGTCCTCTTTATGTTCATAATAGTT GAATGTATGATAAGCAAACTGAAAGTCTGAGACTGTCATTCTAAATCTTTAGGTCATGCATGTAATGTGAAGAACATGCG GAAGACAAGAATCTAAAGATGATAGTCTAAATCTTATGATCCACAATCGAGAGAATAAAGTTGGGCGCTTTATTCATGTT AAGATTGTTATGTTGTCTACTTCCTAACGGAGACGGCTTGTCTTGGTCGTTGGAGCTGGGACTCCATGGGTGGAGACATT GATATAGTTTCTAATGGTGAAATCTATATTGGATCGGACCAAAGTTGAATTATTTTAATTAATAATTCTGTTTGAATAAA ACAATTCACTTTTGATGAATTATATGTTGTCATCTTAATCCTGAGATGGATGATGAACCTGTATACTTGACTTGTATCCT TTGATGTACTAAAGGGAGACATCCTGACATTATGTAAAGGTACGCTTGCCGGTACATTAGGAGTATGACTCGTGTATGCG TAGATTCGTTATTCATAGATAGTGGAATCCATAGCTCTATAAAGAGTCAATGGTATCCTCTTATGCATTATCAGTGGATT GGAAAATATGAGCGCTCAGCCATTGGACTACTCTGTATTATCTAATGGTTTACTGTTTGTAATGATACGAATAGTATTTT TCCGATGGTATGATAATGGAATATAAGATAAATGTAATCGGGAAGGTAAAACGGAACTTGACCTCAAGTCGATTATGGAT ATCCTATGGGGATGATACACTAATATATTGAGTCATGGACTAGAGCTAATCAGAGCTTTGTAAATACGCTATATAAATCG AGAGTGCAGCTCTAGGCTTTTAGTGGAATAGCGCTAGAGTTTTATAATCATGAGACGGACTTGTTGGTTTACAAGTAGCG TTGTGATTATAGGAGCTTGATTTATATATGTCCATCGGGTCCCTTTGCTAGCTCACATAATTTCCTGTAACGATACGGTG TATTTCCTACACATTGGTAATTTGTGTTATTTCCGTAACGAGAGGTTCAAAGTTAATTCATGGGTGAATTAATTGATAAA TTAATTCTAAATAAATTAGTTGAATTATTGTTTTAAGAGTTGTTTAATATGGGAAGACTATTATATGACTGTTTTGATCA GGCAATTTCTCTATTGAATTGCTTGAATCAAAACTGAGGCTCTATGCAAGTTTCCTGTATTGAAAAAGTAGGAAAAACAA CTTTTGTCAGTGCAGACAGGCCGGCCGGTTGGGTAGACCGGTCACAGGTCGACCGGTCCGGTCGACCGGTTAGTGAAGAC AGGTCGACCGGTGAATTAGAACGTCTCTGTCACCGGTCAACCGGTTGTAACGTAAAATGCATGCTGACGTGGCAAAATCG ACTCTGGATGCGATTAGAACTTTGGGAAACCTAATTGTTACGGAAGTATGACTTCCTAAACACTATAAATAGCCTATTAA GTCACATTACTTATTAGATCACTTGAGAGACTTTTTGGAGGCTATTGATAAAAGATTCCTGAGAGGAAAAATTGTTTAAT TCTCCAGAACAATTTTTTCTTTGGCTCTCTTGTGATTGGAAGGAGATCAAGAATACCTAGAGGAGATTAAACGACGTGTG CCCACCCGCACATCGATTGTGAAAACGAGAATAGCAAAGAAGACCAGTTGGTTGAGGCTCTTCCGGTTGCTGTTTGGAAC GCTTAGATCTGTGAGACATGCAGTTTTCTGAAATCTCAAAAGGTATGTTTTAGATCTTTAGTATTTATGTTATATAGCAT CATGAACATGTTCTTGTTTGGCTTTGACGTTGATTAAAAATTTTAAATTCCGCTGCGCACTCGATGCCATTAATTTTCCA ACACCTTGAGTTATCACGGGAACCACTATAGAATCTCTGTGTCCTTATTTCTTTTATTTTTCTGCTGATTTATTTCATTG CTTACACGATATTGATGTCATCCTCTGAGTTCAATCATTATCGTCGAATCGATGGAGCCCAATAGTACTTTATGAAGACA ATACAACATGCATTGCCTAAGTCAAAGGAGGCCATATCAAAGGCGATAGAACCAAGCATATTTTGCCAAAGTTCTTCTTC ACACATGAACTATAAAAGTAGGGTGATGTAGACGTTCGACAAATTCATTCATGCGACAACTGGCTGATCTATTCACTAAA GCACTTCCTACTTTAACATTTGAGAAATTGGTGTCTGGTATTGGAATGCGTTGACTTAAAAATTTTTTATGGATGCACAA GCAGCACCAATTATGTCTGCATAAGGGGGAGTTAATTACGCACTGTACTTTTTTCCCCTTAGTCAAAAATTTTATCCCAC TGAGTTTTTCTTAGTAAGGTTTTTAATGAGGTAGTATTTTCCAAAGCGTAACATAGACAAGAATATTGTATTCTTTTTCC TTCACTAGGATTTTTGCCCGCAAGATTTCTTCCTAGTAAGATTTAACGAGGCAAATTCTTGTATATGAACATCCAAAAGA GGAAGTGTTGTGAAAATTTGAATGATCATATGTCAGTTTCATAAACAACTTTTATTTATAGAAGTTTCATTGAAAGAAGT TTTGTTAAAACTTGTAACAAGAAAAGTTGTTTACTTGAAACTTGTATACAAACATGGCAACATCGAGGAAACGTCAGATG ACCTCCTACTTCAACTATAAATATGCCTTCAATGGAAGGCAAGAGAACCATCGAACTTTGTAAGACACTACAAGAATAAT GACTTTAAGAGACCAAACTTTTTTATACCAAAAAATTTTTGGTAGCAGAAAACACACTTTTTGCTACCAAACTTTGGTAG CTGAAAGTATCAAGGCTTTAGTTACTAAATTTAGTAGCAAAAACAACACAATCCGCTACCAAATATAATTTGGTAACAAA TAACATGGCGGGAAATGAAATTTGGTTCCCGCCAATAGCTTTTTGCTACCAAAATAATATTTAGTAACAAAAGCATAAGA TTCTACTACAAAAAATTTGGTAGCAAAATATGACTTTTTTGCTACCAAACATGTTTTGGTAACAAAAGGTTGGCGGGAAG TAAAATTTTTTCCCGTCCGAGGTATTTGCTACCGAATTATTTTTGATAGCAAAACATATAACATTTGCTACCAAGAGTTG GAAGAAAAATATAACTATCTACCACCAAAATTTGGTAGCGAAAAATTAAGTTTTTGCTACCAAAAAACATAATTTTTTGC TATCAAATTTTAGTAGCAGAAAACATGATTTTGCTACCAAATTCTTATTTTTGTGACAAAAAGGCGTTTTTTGCTACCAA AAGTTGTGTTTGGTAGCAAATCATATAAAAACATTAATATTAATATTTTGTGCTTGTATTGCTTTTTTTAAAAAACTTCT ATGAATGTGTCCTATATTAAGTTTTAACAATCATCCTAGTATATTTTGTATAATAATAATTTGATAATTTAGTTATTTTG TGTAGGTGTAACAAGAGACATGTTCATGTGTACACATATGTGATCTTGTTAACTAAGTATATGTTCCACACAGAGTGGTA TATAATCTCACTATTTGATTGATTTTTAACTTTGAATAATGTATTTCAATTTCAAAACTACATTTTTTGTTATAATGTTA TTAGAACAATGATTCTTAAATAATTTTTGACATTATAATGTTATTTTTTTAATGTTTAATATATGTCTTTCTAGTACCAA ATTCATATTTGGTAGTAAAAAATATGCTTTCAGCTACCAAAACAATGTTTGGTAACAAAAAATATAAGTTTCTGATACCA AATTTTGGTAGCAAAAAACATGATTTTGCTACCAAATTCTTATTTTGGTAACAAAAAGATGTTTTTTGCTACCAAAAGTT GTATTTGGTAGCAAATCATATAAAAACTTTAAGACTTACATTTTGTGCATGTATTGTTTTTTTTTATTTTCCATAAATAT GTCCTATATTAAGTTTTAACAATCATCCCAATATATTTTGTATAACAATTATTTGATAATTTAATTATTTTGTGTAGGTG TAGCAAGAGACATGTTCATATGTATATATATGTGATATTGTTAATTAAGTATATGTTCCACATAGAGGAATATTTAATCT TACGATTTGATTACTTTTTAACATGGAATAATATATTTTAATTTTAAAACTATATTTTTTGTTATAATGTTACTAGAATA ATGAGTATAAAATAATATTTGTCATCAACAAGTGTTTTTTTTTTAATTTTTTAATATATTTCTTTCTGCTACCAAATTAA ATTTTAGTAGCAAAAAATATATTTTCGGCTACCAAAATAATGTTTGGTAACAAAAAACATAATTTTTTGGTACCAAATTT TGGTAGCAGAAAATATGATTATGCTAGCAGCGGATGATGCGAAAGCTTGGGTTAGGATACAAGACCATCCATATGTGCCA GAGTGAGTGTGTGTTGCATTACAAAGAGTACAAAGATTTGAAGGAATATCCGGTATGTGGTCATAAGAGGTATAAAAATT GTAATGCAAAGGAGAAAAAAGTTCCACACAGAAAAATGCACTACTCTCATCTCATTCCAAGATTGCAGTGTTTATTTATG TCTCGACACATCGCTGAATATATGAGGTGGCACAAAGAACAATGTGTTGAGACTGAAGGAGTCCTTCGACACCCTGCTGA TGTGGAAGTGTGGAAGGAATTTGACAAACAATATCCGAAATTTGCAGCTGAACCACGTAATGTTAGATTAAGTCTTGCTT CCGATGGTTTCACGCCGTTTGGAGATATGGCAAATCCATATAGTATATGGTCAGTTTTACTGGTGGCTTACAACATGCCC CCTTGGAGATGTATGAACCAGACACATATCATGATGTCGACATTAATTCCGGGACGGAAGGCACCGGGGAAAGACATAGA CATTTATTTGAGACCTCTAATTGATGAAGTTAAAGGGTTATGGGAGAACGGCGTTAGAACGTACGATGTAGTTGAAAAAA ACAATTTACTTTGTGTGCTGCAATATTATGGACAATTCATGATTTTCATGCATACGGTACTTTATCCGGCTACTCCACCG AATGATATGAGGCTTGTCCGGTGTGTATGGATGAAACCGCTTCATTCCGATTACAGAGTAAGATTTGTTATATGGGGCAC CGTCGTTATTTAAGTCCGGATCATGCTTGGCGTTCTGACTTAAATTTTAATGGTTCTGTTGAAACTAGAATGCCTCCCAA ATCAATATTGTAAGAGAAAGTTATCGTTTAGTTCTGGTTCAAAATCCAAATCTGCTCCATCTCTGCCGGATGTTGAGGCA TTTCCCCGGACTCCTTTAGTGGCATCTTTAGGCACATTAGGCTCATCCACATCTTCACGAGCAGATAATGAGTCATCTAA TGATCATCAACAATTTCATGAGGATCAACCTCCGGAGATTCTATGTATTGAAAATACACGTAAGATCATGTTTCATTATT TTTAATTGAGTTTTTTTTACACTATTCTACATTTAACCTCCTTTGTAAACAACACGGTCAACAAATGTTCGAGGACCAAC TACATGTCAAGGAATTAACAAGTTAGTGTCCAAGAAAGGAAAGCTTCAAGTACAATTTAGGGAATCTGAGCTCTGAGTTT ACAAGAAGCATGCAGGCCGATTTGTGAGCAAAATCGGCTCTATAGTTTGCCACCATGCTCCATTAAAGTATAGTG >DTC_2_7_Mno length=2786;Class=DNA transposons;Order=TIR;superfamily=CMC; AGAACACATGCATGGCAACCACTTCCTAATGAACTCAAATATTGTTTACCAAAAAACGACCTTAAAATGTTGTCTATCTA ACTACAACCTGCAGGTTCACACCAATTAGTTTGTTTTAGAAAGAGGGGGAAATTTGGTCAAACATTTGTTTAACATATTT GTATAAGTTATGGCTTTCGAAAATTTGAAAGGAGATGAGCGTCCAAAAGTTTGAATAATACTATATTGACGATCATTCGG ATTAACAGGACATTTGGCAAAGTTGAAAAAAATTGAATATTGACTGTATTATACTATATTGACGCTTGAAGTGGCAGTTC GCCAGCATACATTTATTTGCATTTAAAATTTATTTGCATTTGTTTAGCCAGCTGACATTAGGCACCAACCTTTAATTCGT AGATCTACTATCATGTCAGATATGGATAAGAGTTGGATTTATGTGACGAACCGAATTTCGGAGACATATATGGATGGAGT TAGAAGATTTATTGAACAAGCACGTAATCACCTAGATGCGGATGGAAAATGTCGTTGTCCTTGCAAAAAATGTTTGAATT GTTTTTTCCATCATATAGATATTGTTGAGCGTCATATTTTTGTTAGAGGTTTTAGCTTAAATTATATAAACTGGATTAAT CATGGCGAGGAGGAAACTGATACTACTCCCAATGTACAAGATGAAGACTATGATACAGAAGGAGAAAAAAGTGACAATGA TGACGACATAGATGAGATGGTGGATGCATTAAATGATGCATTTCCGCACATCAATCCATCTTCAATGGATGATGGTGCAG AAATAAATGATATTGGGGGCTGCGAAGAAGAGACACCTAATTTAGAAGATTTGTTCGCTGAAGCGGAGAGGGAGTTATAT AAAGGATGCACAAAGTTTTCCGCATTGACTTTTTTGGTGAAGTTACTTCATATAAAAGTATTGAATCAATGGAGTAACAA GTCTTTTGATATGTTGTTGAAGTTACTTCGGGAGGCATTTCCAGAAGGCTCGAGAATTCCCAAGTCTTATTATGAGGCGA AGCGGATGATGCGGAAGCTTGGGTTGGGATACAAGACCATCCATTTGGCCCGAAGGAGTGTGTGTTGTATTACAAAGAGT ACACATATTTGAAAGACTGTCCGGTATGTGGTCATAAGAGGTATAAAAATTGTAATGCAAAGGAGAAAAAAGTTCCCCAT AGAAAAATGCACTACTTTCCTCTCATTCCAAGATTGCAGCGTTTATTTATGTCTCGACACACCGCTGAATATATGAGGTG GCACAAGGAACAACGTGTTGAGATGGAATGAGTCCTTCGACACCCTGCTGATGCGGAAGTGTGGAAGGAATTTGACAAAC AATATCCGGATTTTGCAGCTGAACCACGTAATGTCAGATTAGGTCTTGCTTCCGATGGTTTCACGCCGTTTGGTGATATG GCAAATCCATATAGTATGTGGCCAGTTTTAGTGGTGGCTTACAACATGCCCTCTTGGAGATGTATGAAGCAGGCACATAT CATGATGTCGACATTAATTCCGGGACGGAAGGCACCGGGGAAAGACATAGACATTTATTTGAGACCTCTAATTGATGAAC TTAAAGAGTTATGGGAGAACGGCATTAGAACGTACGATGTAGTTGAAAAAAAAACAATTTACTTTGCGTGCTGCAATATT ATGGACAATTAATGATTTTCCTGCATACGGTACTTTATCCGGCTACTCCACCAAAGGATATGAGGCTTGTCCGGTGTGTA TGGATGAAACTGCTTCATTCCGATTACAAAGTAAGATTTGTTATATGGGGCATCGCCGTTATTTAAGTCCGGATCATGCT TGGCGTTCCGACTTGAATTTTGATGGTTCTGTTGAAACAAGAATGCCTCCCGAATCAAAAACGGGCGAGGAACTATTGTT AGAGCTAAGCAAGCTGTGGGTCCCTATGCCGGGAAAGGATGTAGCAGTTCGTGAAGCTGACATGAAAAAAATGTCAGAAG CTGGGTACTCAAACGACAGTAACTGGAAACGGAAAAGTATCTTTTGGGAGCTCGAGTATTGGTCAAAACTTAAGTTGCGT CATAATCTTGATGTAATGCATATAGAAAAAAATATATGCGATAACTTGGTGGGAACCGTGTTAGGAATAGATGGCAAGTC AAAGGACACCAAAAAAGCTCGCTTGGGCTTACAAGAGTTGAATATAAGAAAGGAGTTGCACTTGGATGGTAAGGGGAAAA AGCCTCCGGCATGTTTTACATTGTCTACTACGGAGCGGAAAGCTTTTTGTCAATTTTTAAAATCAGTCAAATTTCCCGAT GGATATGCAGCAAATTTGTCGCGAAATGTCAACATTAACGATGGTAAAATCATGGGTTTGAAAAGTCATGATTGTCACGT GTTGTTGCAACGACTGTTGCCGATAGGATTGCGGCCTTACTTGAAAGACAATGTGTTGGGTCCGATTGTTGAGATGTGTT CATTTTTCCAGCAGCTTTGTGCAAGGACATTGTTAGTAAAGGACTTAGATGCACTACAAGAAGGTATAGTTTACACATTA TGTAAACTTGAGAGGATTTTTCCTCCTGCATTCTTTGATGTTATGATCCATCTAGCCTACCATTTACCAGAGGAGGCAAA ATTAGCTGGACCAGTGCACACTAGGTGGATGTACCCTTTTGAAAGGTATCACTCTATTTAGTGGATTTATGTATATGTTT AGAGATTTTCCTAATGACGAACATGTGTAATTCTCGGGAGTTATATCATAGGACACTAGGGAAATT >DTC_2_8_Mno length=2783;Class=DNA transposons;Order=TIR;superfamily=CMC; CTATGCTATTGTAAAAACTCCCTTTTAGAAGTACCCTTGTGTAATTAGTAATGTCAATTGTCAGTGCTCTTTCACATCCA CCCTTTTGTGGTCAACAATGTAAGAAGAAAAGTCAACTAGGTTCTTAGACGTATAAGATATATTTTTCCTGTGAAAACAC CAAAAACAGGTAATTAGATGACTGAATTTTTGAAAACCATGAACATGATCAATCAAAAAGTTTCTACTTAAAACCTCATG AGTTTCATTTTCTCTGTACGAATCCTTTCCACAACAGAGTTTGAACAAACAACTTGGTATGATTATTTGATTGTAGTCAT ATTTGATAGTTGTTTGTATTTGTTTAGCCGGCAGACATTAGGCACCAACCTTTAATTTGTTTTAGCTTCAAAGTTTCATT GATCATACTTATAGATCTACTACCATGTTAGTTATGGATAAGAGTTGAATTTATGTGACGAACTGACTTTTGGAGACATA TATGAGTGGAGTGAGAAGATTTATTGAACAAGCACGTAATCACCTAGATGCGGATGAGAAATGTCGTTGTCCTTGCAAAA AATATTTGAATTATTTTTTCTGTCATATAGATATTGTTGAGCGTCATATTTTTGTTAGAGGTTTTAGCTTAAATTATATA AACTGGATTAATCATGGCGAGGAGGAAACCGATACTACTCCCAATGTACAAGATGAAGACTATGATGCAGCAGGAGAAAA AAGTGATAATGATGACGACAGAGATGAGATGGTGGATGCATTTCCGCACGTCAATCCATCTTCAATGGCTGATGGTGCGG AAATAAATGATATTGGGGTTTGCGAAGAAGAGACACATAATTTAGAAGATTTGTTCGCTGAAGCGGAGAGGGAGTTATAT GAAGGATGCACAAAGTTCTTTGCATTGACGTTTTTAGTGAAGTTACTTCATATAAAAGTATTGAATCAATGGAGTTACAA GTCATTTGATATGTTGTTGAAGTTACTTTGGGAGGCATTTCCAGAAGACTCGAGAATTCCCGAGTCTTATTACGTGGCGA AGCGGATGATGCGAAAGCTTGGGTTGGGATACAAGACCATCCATGTGTGACATAATGAGTGTGTGTTGTATTACAAAGAG TACAAAGATTTGAAGGAATGTCCTGTCTGGTATGTGGTCATAAGAGGTATAAAAATTGTAATGCAAAGGAGAAAAAGGTT CCACACAGAAAAATGCACTACTTTCCTCTCATTACAAGATTGCAGTGTTTATTTATGTCTCGACACACCGCTGAATATAT GAGGTGGCACAAGGAACAACGTGTTGAGGCGGAAAGAGTCCTTCGACACCCTATTGATGCAGAAGTGTGTAAGGAATTTG ATAAACAACATCCAGATTTTGCAACTGAACCGCGTAATGTCTGATTAGGTCTTCCTTCCGATGGTTTCATGCCGTTTGGA GATATGGCAAATCCATATAGTATGTGGCCAGTTTTACTGGTGGCTTACAACATGCCCCCTTGGAGATGTATGAACCAGAC ATATATCATGATGTCGACATTAATTCCGGGACGGAAGGCACCGGGGAAAGACATAGACATTTATTTGAGACCTCTAATTG ATGAACTTAAAGAGGTATGGGAGAACGGTGTTAGAATGTATGATGTAGTTGAAAAAAAAACATTTTATTTTGTGTGCTAC AATATTATGGATAATTCATGATTTTCCTGCATATGGTACTTTATCTGGCTACTCCACCAAAGGATATGAGGCTTGTCCGG TGTGTATGGATGAAACCGCTTCATTCTGATTACAAAGTAAGATTTGTTATATGAGGCATCACCGTTATTTAAATCTGGAT CATGCTTGGCGTTTCGACTTGAATTTTGATGGTTCTGTTGAAACTGGAATGCCTCCCAAATCAATATTGGGTGATGAACT ATTGTTAGAGCTTTACAAGTTGTGGGTTCCTATGCTGAGAAAGGATGTAGTAGTTCGTGAAGCTGACATGAAAAAAAATG TTTGAAGCTGGGTACTCAAACGACAATAACTGGAAATAGAAAAGTATCTTTTGGGAGCTCGAGTATTGGTCGAAACTTAA GTTGCGTCATAATCTTAATGTAATGCATATAGAAAAAAATATATGCGACAACTTGGCGGGAACCTTGTTGGGAATAGATG GCAAGTCAAAGGAAACCAAAAAAGCTCGCTTGGGCTTACAAGAGTTGAATATAAGAAAGGAGTTGCACTTGGATGGTAAG GGGAAAAAGCCACCGGCATGTTTTACATTGTCTACTACGGAGCGGAAAGCTTTTTGTCAATTTTTGAAATCAGTCAAATT TCCCAATGGATATGTAGCAAATATGTCCCGAAATGTCAACATTAACAATGGTAAAATCATGGGGTTGAAAAGTCATGAAT ATCACGTGTTATTGCAATGACTGTTGCCTATAGGATTGTGGCCTTACTTGAAAGTCATGTGTTGGGTCTGATTGCTGAGA TGTGTTCATTTTTCCAGTAGCTTTGTGCAAGGACATTATTAGTAAATGACTTAGATGCACTACAATAAGGTATAGTTTAC AAATTATGTAAACTTGAAAGGATTTTTCCTCTTGCATTCTTCGATGTTATGATCCATCTAGCCTACCATTTACTAGAGGA GGCAAATTAGCTGGACCAGTGCACACTAGGTGGATGTACCCTTTTGAAAGGTATCACTCTATTTAATGGATTTACGTATA TGTTTAAATATTTTCCTAAATAAGAACAAGGGTAATTCTCCAAAATTATATCACAGGATACTA >DTC_2_9_Mno length=2777;Class=DNA transposons;Order=TIR;superfamily=CMC; GTCTCCATATATCTTGGTGCTCCTCACACTAACCAATTATACCCTGCAGCAATCGCACACTTGCTTCTCAATGTGAAATC ATAAATTTAATTATAATTCGAAAATATTTATTACTTTCCCTTGAAAAAAAAAAAGAAATATCATTACTACCAAAGTATTA TTTTCATTATTGTCACTCAAATTGTGAAACTATCTTCATTCCCAGCAAAATCTCCACAAAACATTTTAACCCTTTACACT TGTAATCACTTTGGCCATACTTTTCAGCAGCTGAAAAGGCAACATCCATTGTTTTCCCCGCACTCAATCCCCAATCTTTC ATAAGCTTTTCTGCATCTTGTTTGACTCCGACACCGGCAAATGTCACGTTCGAATCACCGAGGAACCCGGGCAGCGACCG GGGAATCTCCGGTGCATGGGAGAGCTGGAATATGAGGCAGCGGTTCTCAGTGCAGAGCTGAAGAAGTGTTACGTGCTGAT CATGTGATCTGGGCTTGGATACGTTGATGGGAATCTTCCACTCTGTGTCTAACCCTAGAAAAAAGTTTTCATGTAAGTTT TCAGAAATCCAACAGTTTACAGTTTCAGGATCGGCGGTTACAATTGTTTTGATGTGGAGTTCGTAGAATTCAATGTCGTA TGACTTGAACTCCTCATGAATATTGTTAATGTTGGCTAAAGAAGCCATATATCATAAATAAATTGAGAAAGCTACTGAAA AAGGTGGTGTTGACTATTGTTAATGTTCGGTAATGATGCATTTCCGCACGTCAATCCATCTTCAATGGTTGATGGTGCGG AAATAAATGATATTGGGGGCTGCGAAGAAGAGACACCTAATTTAGAAGATTTGTTTGCTGAAGCCAAAAGAGAGTTATAT AAAGGATGCACAAAGTTTTCCGCATTGACTTTTTTTGGTGAAGTTACTCCATATAAAAGTATTGAATCAATGGAGTAACA AGTCTTTTGATATGTTGTTGAAGTTACTTCTGGGACATTTCCAGAAGGCTCGAGAATTCCTAAGTCTTATTATGAGGCGA AGCGGATGATGCAGAAGCTTGAGTTGGGATACAAGACCATCCATGTGTGCCCGAAGGAGTGTGTGTTGTATTACAAAGAG TACAAATATTTGAAGGAATGTCCGGTATGTGGTCATAAGAGGTATACAAATTGTAATGCAAAGGAGAAAAAAGTTTCACA TAGAAAAATGCACTACTTTCCTCTCATTCTAAAATTGCAGCGTTTATTTATGTCTCGACACACCACTGAATATATGAGGT GGCATAAGGAACAACGTGCTGAGACGGAAGGAGTCCTTCGACACCCTGCTGATGTGGAAGTGTGGAAAGAATTTGACAAA CAATATCCGGATTTTGCAGCTGGACCGCGTTATGTCAGATTAGGTCTTGCTTCCGATGGTTTCACGCCGTTTGGAGATAT GGCAAATCCATATAGAATGTGGCCAGTTTTACTGGTGGCTTACAACATGCCCTCTTGGAGATGTATGAACAAGGCACATA TTATGATGTTGACATTAATTCCGGGACGGAAGGCACCGGGGAAAGACATAGACATTTATTTGAGACCTCTAATTGATGAA CTTAAAGAGTTATGGGAGAACGGCGTTAGAACGTACGATGTAGTTGAAAAAAAATAATTTACTTTGCGTGCTGCAATATT ATGGACAATTCATGATTTTCCTGCATACGGTACTTTATGCGGCTACTCCACCAAAGGATATGAGGCTTGTCCGGTGTGTA TGGATGAAACTGCTTCATTCTGATTACAGAGTAAGATTTGTTATATGGGGCATCGCCGTTATTTAAGTCCGGATCATGCT TGGCGCTCCGACTTGAATTTTGATGGTTCTGTTGAAACAAGAATGCCTCCCGAATCAAAAACGGGTGATGAACTATTGTT AGAGCTAAGCAAGCTGTGGGTTCCTATGCCGGGAAAGGATGTAGCAGTTCGTGAAGCTGACATGAAAAAAATGTCAAAAG CAGGGTACTCAAACGATAGTAACTGGAAACGGAAAAGTATCTTTTGGGAGCTCGAGTATTGGTCGAAACTTAAGTTGCGT CATAATCTTGATGTAATGCATATATAAAAAAATATATGCGATAACTTGGTGGGAACCGTATTAGGAATAGATGGCAAGTC AAAGGACACTAAAAAAGCTCCCTTGGGCTTACAAGAGTTGAATATAAGAAAGGAGTTGCACTTGGATGGTAAGGGGAAAA AGCCTCCGGCATGTTTTACATTGTCTACTACGAAGCGGAAAGTTTTTTGTCAATTTTTGAAATCAGCTAAATTTCCCGAT GGATATGCAGCAAATTTGTCCCGAAATGTCAACATTAACGATGGTAAAATCATGGGGTTGAAAAGTCATGATTGTCACGT GTTGTTGCAACGACTGTTGCTGATAGGATTGCGGCCTTACTTGAAAGACAATGTGTTGAGTCCGATTGCTGAGATGTGTT CATTTTTCTAGCAGCTTTGTGCAAGGACATTGTCAGTAAATGACTTAGATGCACTACAAGAAGGTATAGTTTACACAGTA TGTAAACTTGAGAGGATTTTTCCTCCTGCATTCTTCGATGTTATGATCCATCTAGCCTACCATTTACTAGAGGAGGCAAA ATTAGCTGGACCAGTGCATACTAGGTGGATGTACCCTTTTGAAAGGTATCTGACTATTGACTGGATTTACGTATATGTTT AGAGATTTTCCTAATGACGAACATGTGTAATTCTCAGGAGTTATATCACAGGACACT