>DTC_19_1_Mno length=8260;Class=DNA transposons;Order=TIR;superfamily=CMC; CACTACCAAAAAAATTGAAAAAAAAAAAAAAAAAAAAAGGAACGCACGATACCAAGAAATTAATGATTATTTTCATAAGG GTGCTTTGTTTACACCCTCATCATACTTTTCATACACTTCCTAATAAAACTTTTTGTTACTAAATTACTAGTGTTTTAAA AAATACACATTACACACCCCGTCTCAAAAAAAAAAAAAGATTGTTTTCCTAATATATATATATATCCTCCTTGTTTTCTA TATTGATTGTATATAAACTGTCTACCATCGAGAGTATATAAACTCTCTTCGTCTTTTTTTTTTTTTTAATGAATACGTTT GCATAGTTATACCATTTGCTTTTTTAATAACTATATATTATCATCATATAATGCAAAATATTATATGTACCACTACGTTT GGATTCTCTTTTTAATTTCTACTGTATTCACATTTTTGCAACTTTTTTTTTAAGAATCAGATAATATGACAAAAGTAATG ATCATGTGTAGTGTAAAAAAAGAAAATAATTGGAAAGGGAAAATAATCGTTAAAAAAAGAAAAAAAAAAAAGAGATAAGT TTAGTTAGTGGATGGGTGAAAAAAAAAAAAAAAGAAAGAAAAATGATACAATTTAATTCAAGAGAAATTTTTAAAATTTT AAGAGAAGTGTAACAAATAGGATTAGGGGGATGTATTCTTTTATAAATGTTCCTTGAAGTATGATCATTTTTCAAAGTAC CCCTAGATTTTTTAAAATCACTTAAACACCACCCCCACCCACCCATCCCCACCAAATATCTCGAAACCATTAAAAAGGCT CCATATGCCAATTAAAGTTTGAGGAGAGAAGTGAAGGAAAAGAATAGCACTTTATAGGTTATTAGACTTCCATCTTAAAA TATTAACTTTTTTAAGTGGGATAGCTTAATATGCTTATATGGATGTGATTATATTTGTATTTAGACGATGTGAAACTCGA GTATTTTACCCTTAACACTCCCCTGCAAGATGGTGCTACGCTAGGAATCACTAATCTTGTATTTTTTATGGATCCCAGCT TGTTTGAGCTATATATAGGCTCTGATACCATATTAGAGTTTGAGGAAATAAGTGAGGGAGAAGAATTGTACTTTTTATGT ATTGAGCTTTCATCTTAAAAGGTTAACCTGTTTAAGTTTGGTTGGTTTGTTTTTTTTTTTTTATCCAACTTGTTTGAGCA ATGAGCTCTGATACCATATTAGAGTTTAATGAGAGAATTGTGGGAGAAGAATTGCACTTTATAAGGTATTACGCTTCCAT CTTAAAAAGTTAACCTGTATGAGGAGGGTAACTCAATATCCTTATATGGTTGTGGTTATGTTTATATTTAGACGATGTGG GACTCGAGTATTTTACCCTTATCACGCTCCCACAAGATGGTGCTATGTTAGAAGTCACAAATCTTGTACATTGACGGATC AACCCAACTCGTTTAAGCAATAGGCTCTGATACCATATTAGACTTTGAGGAGAGAAGTGAGGGAGAAGAATTGCACTTTA TAAGGTATTAAGCTTTCATCTTAAAATGTTAACCTGTTTTAGTGAAGTGACTCAATATCCTTATATGGTTGTGATTATGA TTGTATTTAAACAATGTGAGACTCAAGTATTTTACCCTTAATACGTCTCCGCAAAATGGTGCTCCGTGATGTATTTTGTA TTAATCGACTCAACTTGTTTGAGCAATAGGCTCTCATCCCACTTGCATCTATATGTCTAATGGATGTAGTGACATGGTAT GCTACAGGGGGTACAATGAAAAATGTCAAGGGGCGCACTTAAAATTGGTCAATAAGTCAGGCACGGATAAATAAATCGTT AAAATGTAAAAAATAAATAAATAAATAACAATATTAATATGATTAATGGTATATCTATCAACTATAATTAATAAAAAGTC AATTATATATCAACTTTATTTAGTTACTCGAAAAGTAATATGCTTCTAATGGAAATTTATAAATTGAAAGTTCACTCTAA TTTAAATCATTTTTTTTTTTTGTTAAATATTTGTTCTAAAACTTAATTATTATAAAACTCAACCTGTAAATACGCATTTG AAAATGCCCAAAATTTAACAAATGACGTCAACTCACATGATCTTTCTAGCCGTCCAGACAAATTTCAAACAACTAGTTCC GACTGCTTAGAAAATCAAATGGGCATAATGATTAAAATATTTTCAAATGGGCTTACAATTTGAATTTCGTAATGATTAAG TTTCAGGAAAACTATTTTACAAATATTTGATCTAAATTAAAATATATCAATATTAATGTAATTAGAATTTGTAATTTAAT TTTTATTATTATGATTGACAAATATGTCATAATCATAATAATTTTTTAATAATATCTTTGTACATTGTAAGATTCATTTA ATAAATATCCTTCAATTTATTGACTAATTTTTAATGTGCTCCCTAAAGTTTTCTTCAAGATAGTGCACGTCACGTCAATA AATTTATTATATATAAAGACAGAAATGCACAGAGAGACTATTTTGAATGGTTTTCAAAACATCAGAAGATGTTTTGAACA GTTTTAAAAAATCAAGTAGTATTTTAAAAAAAGATCCATACTTTAAAGAGCATTTATAAAAATAATTTACTTATTAAAAA AATATTAATTAATTTTTTTTTATTTACTTATATCGCCTTCTCAATACGAAATACTAATATATTACCATTTTCATTTTAAT TTTTTAATGGAAACAAAATAACAAACAAATCAAACACTAAGAAATACAAATAATCAATCTAGGGAAAAAAAAACAAGGAA AACTATTGTCACATGGAAAAAAGTTAGATGCGAAAAAGTTATGTGATTTTATGTGGGATTTTTTTACTGTAGCGAAAAAG TTAAATGTGACTATTTTTTAAAGTTTTTTACTGTAATAAAATTCAAATCGGTGAAATAAACAGGACCATACCTCTTTGTC TGTTGCGGTGAAAAAATTCACCCCTGAAACCCAGTAGCCACAGTCGCGCCTCTTTTTTCACGTGGTAGAAAGGAGAGAAT TGGCATATCAGAAAACCTTCTGTTGCGGCAATTTTTTTTGCCGCTCATGTGTATTTTCTATTTGTTTTTATCTAAAACAT TTAAAATACATAGGGGTGACAATTCGTGTCACGTATCGTGTTTTGATCGTTTCTTTTTAAATTTACAGTCAATCCGAACA CGACCCGTGGCATGAAATTTTTTAAAAACCGCAATACGAACACGATACGACCACTTTATAAGTTGACACGACACGACCCG AAAATGACCCGTGACACGAAATTGACACGAAAATTGTATACTTTTATTTAGTTTTTTACATATTAAAAATAACTTAAAAT TCATAACACACTAAATTACAATAACATCCTTTAAAATTAAGCAACTAATAGTATAAGATTTTGAGTATAACTATCATGAT ATCACAAGTTCATAATAAAATTTAAAATATGAAATGAAAAATATATGTATTTTTTAGTTTTTTACGAGTTTCGTGTCGTG TTCGGATTAGGAGGGTCCAACCCGAAATTGACCCGTGTTTTTCGTGTCAATTTCAAGTCGACCCAATTTTAACCTGAACC TCTTTTTTTTCAATCCTAACCTGTAAAATTCGTGTCATTTTTGAGTCGTATCGTGACCCATATTACCGGCCTTAAAAATA CGCGTGTTTATTTCAGGTGAAAAATGAAAATATATAACGCGAAAATAGTCACCGCTATATGTGCACTTTTTGTTTCGTCT ATCCCAAATAACGTTTGAAATACGTGCATTTATTGTAGTAAAAATTAATTTCTATACCGGCAAATATTTTCCCCGCTATA GAATTTTTTTTATTTCAGAATTCCATATTCAGAGATTAAGAAGAAAAAAATGAATAAAACCCTGTAGAGGTGATAAATTG CGCCACTATAGGCTACTCGCAGGGCAAAACTTGCCCGAGCTTCTACTTCTCCATTTTCTCCAAAAACTTCATCTCTCTAA AATCTCCCCTTCTCTCTCTAGACTAGAACCCACCTTTGTTTCCCCATTTTCTTGAAAATTAAGCTTATATGCTTAAAATT TTTTGTTCCCTTCCTCTTCTCATCATCCCGAAGCTTCGTTGGAGTGTCGTCGGAAGCCGTCGCCGAGCTGCCGGAGTCAG TCGCCGCCCCTCTGCATTGCTTCCTTCCTTGCTACAATTTCCAAGTAAGTTTCATGTTTATGAATCTTGAAACCTTGAAA CTTAGTTGTAGTTTGTCAAATTATGGTGTGTTTGTGATTTGGGATTTTAGTTGTAATTTGTGATATTATTTAATTTTGTG ATTTTTTTTAGTTGATTATGTTAGTGAATGTGATTTGGAATTGATGATAAAGTTGTTAGAATTGATTGGATTAGTTTAAT TGGGAATGTTCCAAAAAGAAGAAAAAAAAATCGAATGATTTAATATGCTTCTTTTATTGTTGTGAATTTAATTTTGCACT CTCACTCTAGTAGGATTTTTGTATTTATATGTGCTTTTTCCAATAATTTTGAATTATTATCATTGGTTATGGAATGAACT TATTTGTTATTGGTTATGGAATCGACTTGTAATTATGATGTGGTGTTATTATATAGTGTGTGTATGGTAAAAGTTAAAGC CTTTAAGGGTGATTTGATAGATAATGGATATAGATTTGGAACTTGAGGAAGTAGCCTATGCTAGGAATATGATGAATATG TTATAAATATGAGTTAGATTATGTTACAGCCTCGTTCGTTTCGCTGATTCGAGTTTTGCTACAGTAAAAAGCTCTCATAA ACAATCACATTTAACTTTTTTACTATAGTAAAAAGCTCTCACATACAATCACATCTCAACTCGAATTCTAAACTCGAATC AGCGAAACGAACGAGGCCGTAGTTGAGCAAGTTTGAATATGTTTGAATACGTTTAGATTTGGATTTGGATATGGTAGTAA TGTTGAGTTTTATGTTTTTTTTTTTTTTTTGCTTTGATGTAATTTCATTTAATTATTGTTTTTGTGTTAATTAATATTGT TAACAAATAGGTGCCTTTGATAGTTTAGAATGTCATTTGACAAAAGTTGGACGCAATTACACAATCGATTGTGTAATGAA TATCAAAACGGGGTGAAATCATTTCTTGAAAGAGCTAAAAATACTTTTAAGTACTTTTGAAAAGATTAGATGTCTATGTC GGGATTGTTGTAATGGAAAATGACATTTTTTGAATGTAGTGGAGGCTCACTTATTAGATCGGGGTATGCAAGAAACATAC AAGTTGGCGCCTTGGGTTTATCATGGCGTAGATTTCAATGAACCTGTTGACTTAGGGGAAGATGATGATGAAGTGCGTAA TGATGTTGAGATTGATGAAGCCATTAATGATGTTGAGAATGATGATTGTTATGATTTGTTGCATGATGTTGTTGAAAATG ATGTGGAGGATGTCGACGATGTTGTTACTGAATTTCCTGGAGGTGGAGCTAATGCTGAGAAGTTTTACCTTTTTGATGAT ATGAATTATGAAACGACCATTGTACCATGAGTGTGAAACAGTGTTGACATTCTTAGTGAAATTAATGCATGTGAAGGTTC TAAATAAATGGACTAACAAGTCTTTTGATATGTTATTTGATTTGCTTATCAAAGCAAGCCAATAAGGACAAAGATGCCAG TTCACATTATGAGACTAGGTCATACTTGCGTGCACTTGGCTTAGGGTACGAGTCCATTCATGCTTGCAAATATGATTGTG CTTTATTTTGGAAGGAAAATGCGAACTTAAAAGCATGTCCAGTTTGTGGGACAAGTCATTGGGTTGATAAGAAGACTAAA GGAAAAAAGATTCCTCACAAGGTCTTGCGTATTTTAGGCTAAAGCCTTGTTTACAACGATTGTTCCAGTCAGCTCGTACC GCAAAAAATATGAAATGGCATGATGTTGATCTTGATAAAACTGAAGGTGTTTTGAGACATCCAGCAAATGCTGAGGCTTA GAAGAATTTTGACAGAAAATATCATGATTTTGCAAATGAGCCAAGAAATGTGAGATTGGCATTGGCATCCGATGGATTTA ATCCTTTTGGTAATATGAGCAATGCCTATAGCATGTGGCATGTAGTCTTGGTTCCATATAACATGCCACTTTGGAGATGC ATGGAGTCATCGTTTATGATGAGTTTGTTAATTCCAGGACGTACAGCCCCTGGGAAAGACATAAATGTATCTGCGGCCGT TGATAGATGAGCTTAAAGAGTTGGGGTTCGAAGGAGTTCGAACATTTGATAGTGACAAAAATGAGTACTTTCAATTGCGT GCTCATATTCGGATGGGGCTCAATGTGTGCGCTCGCGACCTGCGGACACGAATGCCGGACCGGAAAACCCGCTCTGTGCG AGCTACATTTTTATTTTTCCCATCAGAAATCCGAAACTGCTGCATTAGTTTTTGTTTAACTCTGCATTAGTGTGGGATTT GGGAAAACTGCAGCATTATTGGCTGGTTAATGGACAATTAACTTCCGAATGAAGACATACATTGAACTAGGTTCTTCAGG GGCTGTAACCTCTAAATTAAGCACCATTAATCCGAGAATAAATCCGGATTTATACACCATAATGTCATGGTGTAACACCC GGATTTTGGAGCCTATATAAAAGGCCCTCTCCAGTCATTTGAAGATACACTTTTCCAGAAATCTCTTCCTCTCACTCCGT TTCTCTCTTGCTTCTAAAGTTGTGTGTTTTCTTTGTCTTGTTTAGTTCGGTTTTGGTGATAGAGGAAAGATCAAGTTCTA GTTCGCCAGACGGTTCCGAAAGTGCATCGAGCTACCGTCGTTATCGTTGTATCCTGGGAGACGGACGTCCAACGTAACCT CAAGCACACGCCGGAGGGGACGAATCTGTTTTAAGAAAAACGTAGTCCACGTGCCTCGACATCCTTGCAACTTTCATTTC TGAGTTTTGGTAATAAGGTTGAATTACAATTGTATAAATTTCGGTTTTGTTCTTCTATAACTTGTTCCTCTTTTGTATTA TCCACTATTTCGGCTAACACTTACTTTTATGCTTTTTTTGCATTATAATAGCTTTATGTTGGTATTATCTATCTTACTAA AAACAGAGAAAAAGCATAGTTCGAATAGAGAACAATTGGGTGAATATGTAGGGGGACATGGGACCAATTCATATGCGGCG CACAGAGCAGAACACAAAAATATAAGCCCTATTGAGTTTCATAAGATGATGCATTGGGATGAAAAGACTGGTTGGAGTGA TTCTTTGGCAGAGTAACATTACGTGAGTATACCCAAGTAATTTATAATTCCATTCATTACATATGAATTCAATTTACAAG TGTTTTAATCCTTAACAATTTATTTGCAGGAGGAGATGGTTCGAATTCGCAAAGTACAACAAGAAATTTAGGAGCAAATT GAAGAAGGAACATTTCCACCACGCAGCAATTGCCTTTCAGATCAAGAAATTGTGGATCGAGTTCGCAAACCCAGATCAAG ATACATAAAGGGATTTAGAAATAAGATTGTTGATTCGAAAAGAGCTCTCCCTGGTTGTTCTTCCTCTTCCTCTTCTCAAC ATCCGAAATATGAAGAGTTGTCCCAGTGATTCAGTAACTATAGACAATCTGATAAGCCCCCCGTGCGTTTTACATATGTT CGGAGGAAACGCCACCACGAGCCAAGGTTGGCAGCTGAAACTCAAGTGGAGGCTGACGTGGAGGGAGGAGCTCGGGAAGA GGAATTAGGAAGTGGCTGAGTCAGCAGGAAGTTACTAGTTAGTTAGCATTGGGATCAGTGAGGGAGAATAAGGCTTAGTA GTATAAATAGAGTAGGAAGGGGAATAGAAGGGAATCGAATCATCTGTATACTTCCGAGAGTGGAACCTAGGAGAGCAAGG GATCTCTCGAAAATTCCCTTAGTCCCTTGTAACCAATCGTCCGCCATTAATACAATTCAAGCTTCCGATAGTATTCCTAG GAATTCTGTCTCAATTCTACTAACAGAGAATAGGAGTCTAACACAATCTCAGGAGGTACATAATCTCTAGACTCAACAAA CAATTGATCATTTGACTGAACTGATGCAGTCTCAATTTTCTCACCTTTTCCCACAATATGGACCTCCCCCGCCGCCACTG CAATGAACAAGTTTGGTTTTCTTTACTACTCTCTAGTATTTATCTTGCACTTAGTTTCAAATTAGAACTTTTCTTTTTAT GGGACTTGATATTCTTAGTG