>DTC_18_1_Mno length=3946;Class=DNA transposons;Order=TIR;superfamily=CMC; CACTACAACAAAAAAGGTTATTAGTGACGACATTATTAGCGACCACATTTATCGTTGCTAAATTTATAGTATTAGCGACG ACATGTCGTCACTTAAAAGAAAAAAATTTTTTTTGAATGACTTGTCGTTGCATTAAGCAATTACGACGACATGTCGTCAC TTAAAAGAAAAAAAAAATTTTGAATGACTTGTCGTTGCATTAAGCAATTACGACGACATGTCGTTGCACAAAATTTCTCT ATTTACGACGACATGTCGTCGCTAAAATTGAACGGGTTATTCACGACGACATGTCGTCGCTAATATCCGTTGGCGCCAAA ACCAATCTGGCGCCACCAATTTTGGCACCAGTTTGTACATTATTTGCGACGACATGTCCTCACAAATATTGATTGTTATA GCTGGCAGTGACGTGACCAAAAAGAGGTGGGATATTTTACGGTTTTCCGTGAATAGGTTCCAGATATTTCTTTATTTTTT ACGACGACTATACAAAATGTCGTCGCAAAAAAATGGTTTCAAAAAATTCTTTTCAGAACGACTGTATTTGCGATGACACA TGTCGTCAGAAAAAAGGGTTCCAGAAAATTCTATCAAGGACGACTATTTTTTACGACGATAATTTTAATAATATGGGCAC AAATAAAAAGGGATTTAATTTTTCACCAAAAAAAGGGCAGAAACTTTGGCGGTTTTCTTAAAATTATTTGCGACGACATT GTTAAATTATCGCCGCAAAAAATGAACCAGGGTATATTCCCTAAGAATATTCTCAGAAATATTAATGAGGTGAAGAAGAA CGCCATCGTAGACCTCCTTCTGCCATTTTTCCCGGTGAGCCTCTCATGTTTTCCCTTACTCTCTCTGTCCAAAACCATCA AAAACCATCCAAAAACACTGAAAATAGCTAAAAAAATATCGTTCTCTCCTCAAATCTTTCATTTGTGGAGAAAAAGTTAA AAAACGCGGAGTTTTCATCTCCCCCTTGCCGCCTACTTTTCCAGCCACACTCGCCGTTTTCTGGCCGTCGGCACCCTCAT TTCCCTGCATCCTTACCGTTCTCCAACCCCCGGTATTTATGGATTTGGATTTTGTGAGTTAATATTTTGGTATTTTGTTA ATTAATTTTGGTATTTTTGTTATGGTTTATGATTATGTTTTAGATTTTGGATATAGTTTGTGCTTTTGAATTTAGAATTG TGAATTTTAAATTAGAATTGAAACTGAAATATGTGATAATTAGATTAGAATTTGTATGAAATTTGTTTAATGATGAGTAT GTGATAATTAAAAAATTAGATAAAAATTTTAATTAGGATTATATTAATAATAAAATAATTAAATAAACTAATGTTAAATA CTTATTATAAAATAATTTGTGTTAATTTTCATAAAATTTGATAAAACTTTATAAATTTTTTGTAGTAGAGATGCCTATGG ACAAGAGTTGGATACATTTAAGGAACCGGTTGTCTGATAAGTACTGGGATGGTTTGTGTGCTTTTTATTGAGGTTGGAAA TAATTATGCAAATTCACTCGGGGGTATTAGTTGTCCGTGTATCAAGTGTAGAAATCATGAGATGCGTCCACCCGAAACAG TGAAAGCGCACATACATTGATGGGGTTTTGATACAAGTTACACCACATGGATTCACCATGGTGAAGTATGTCCTGCTGCT GCAGTTGTCAGTGAATCTGTTGACGAGATGTTTGCAGTGTTAAGTGATGTGGCTGGAATTAGTGATGATCATGAGACAAT GGGTGAGACAAAAACAATTATAGAAGATACGCATTATGATGAATTTAGAGATCTCTTATCCGAGCTCCAAGTCGGATTGT ATCCGGGTTGCACTAAGTATTCATCGTTGAATTTTTTAGTGAAACTAATGCATCTAAAAGTGTTGTACAAGTGGCCTAAT GAATGCATGGATGAAATGTTGAAGTTACCGAGAGATGCACTTCCTGAAGGGAACAAGTTACCTACATCGCATTACGAGGC AAAGAAGTTATTGAGTAAACTGGATCTGAGCTACGAGGTAATTCATGTGTGTAAGTATGATTGCGCTTTGTTTTGGAAGT AGAATGCTGCGTTGCAGTCTTGTCCAGTATGTAGTACAAGTCGTTGGAAGAGTAAAAAGGGAAAAAAAGTTCTGTGGAAA ACACTCTGATATTTCCCTTTGAAGGATCGGCTGAAGTGTCTATATGCTTCCCGTTAGACTGCTAAGGAAATGACGTGGCA CGTACGGGGGTGTTCGAGGGATGAAGACTTAATGCGTCATCCAGTTGATGGTACGGAGTGCAAATATTTTGACGAAAAAC ATCCACAATTTGCACGTGAACCGAGAAATGTTCAATTAGGGTTAGCGACTGATGGTTTCAACATATTCGGGAATATGAGT CTATCATACAGTATGTGGCATGTTATTGTGACTGCATATAATTTACCCCCATGGCTATGTATGAAGGACCCATATAAGAT ATTGACGTTATTGGGATGAAAGGGTTGTTGTTCGTGATGCTGCTACGAATACATCGTTTCGGATGCATGCAGTGTTGCTG ATGACAGTTAACGACTTTCCTGCGCGTAGTAGTTTATCTAGTTAGAGTGGTAAGGGTACTTCGCGTGTCCCAATTGCAAT GATGCAACTCCATCGAAGCGAATAACGAGTAAAATTTACTTTGTTGGGCATATACAATGGCTTCCTATGAGTCATAGGAT GAAGACTAACAAAAAGTTTGATGATAAGGTTGATCGACGACCTTTCCCACCTCAGAAATTCGTTAAGCAAATATTGGCTC AATTAAAAAGGGTGGAATCTCGATTGCCAGGTAAACATGAAAAATTTGGCAGTAAGAAGTGAAAGAGACATCCGACAGAG CTTAATTGGATGAAGAAGAGTATCTTTTGGGAGTTACCTTACTGGACCTCATTGTCGCTACGTCATAACTTAGATGTCAT GCATATTGAGAAGAATGTGTGTGATAGTTTGTTGGGCACAATTCTAAATATTGACTAAAAAAGTAAGGATATAGATAAGG CGATGATCGATTTACAAGATATGAGGGTACATAAGGAGTTACATTTGTATAAAGATGGTGATCGTTGGATGAAACCATAT GCAACGTACACATTGACTCCGGCAGATTGTAAAAAGTTTTGCGATTTCTTAAAGTCAGTACGATTTCTTGATGGGTTTGC TTCAAATCTTCAGAAAAACGTGATCGATGGAAACAATAAATTTATTGGGTTAAAATCACACGATTGTCATGTCATACTGC AGCGATTATTGCCAACAGCGATTCGACCATTTATGAAGAAAGAAATTTTCGATCCAATTACCGAATTGAGCAACTTCTTT CAGTTGATATGTTCTAGGACATTGCAGATGAGTGATTTAGAGATAGCCCAACAGGATATTATTGTTATTTTATGCAAGTT AGAAACAATTTTTCCTCCAGCCTTTTTTGATGTAATGGTTCATTTAGTAATACACTTGCTAGAAGAAGCCATTCGAGGAA GACCTATTCATTTGAGGTGGACGTATCCTTTCGAACGATTCCTTGGTTTATTAAAAAAAATATATGAGGAATCAGGCAAG ACCGGAGGGTTCGATTATCGTGGCTTATATTATCAACAAAGCACTGAATTTTTGTTCAATGTATCTAAATGGCATTGAGA CAAGATTTAACAGACTTGAGAGAAATTAGGTAGACGACGCAGATGGTAGTGTGAAGAAAATATCTGTTTTCCAATCGAAA TACCGTCCAATTGGGAAGATGATCCTGATGACATTAGACAACCAATTACGAAGTAAGGCCGAGTGGTACATATTACACAA CTGTTCAGAAATCTAACACTACATTAAGTAAGTATTACCTCATTGTTTTATTACATAATTGAGTCACATGAAATGATAAC ACTAACTCAAATTTATAATTTCAGTG