>DTC_17_1_Mno length=7963;Class=DNA transposons;Order=TIR;superfamily=CMC; CACTAACTAATGACCAGGCACGTCACATCATAATTTGTTATTTGTAGTTCCTTTTCGCTATCAATTTACAATGGCAAAAG GGTAAGTGGAAAGATCACGAATCAGAAAGTAAAGCGTTTCTAGTGTGTATTAGTTAATAGTTTTTTATTATAATTAGTGA ATTTTTTAATGTCGGAATTTTCTTTTGTAACTTTTAATAGTTGCCCAAAATCGTTCAAATTATTAGATGTGCCACAAACT ATCAGCTTAATCCCTTAAAAAAGACTATTAGCTTTATTTATCAAAACTGCATAAGTTTCATTATTATTATTATTTTGACT ATTTCCTTGTGGTGTCTTTTGATAACTTTAGTGACATTGATTACATTTTTGTTCATTTATATCTTATTTCTTTGACAAAT AGGTTATTGGAAACTATTCAAAAGTAAGAAAACTTTGGGTTCTGTTTGCTTGAAATTGTTATCTTTCGTGTCTTGTCTTA CTGCTCAAAATGGCAGAAGATAAGAGTTGGATCCAAATGAGTCGGTCTTCCAAGGAGTACAAAGCTGGAATTAAGGGGTT TATGGAAAAGGCTAGACTTTATGTGAATGAAGAAGGAAAAACACGATGTCCAAGAATAGTTGAAAGTCATTTGTTAACTG CGGGAAGCTACCGAACATGGGTCTTTCATGGGGAAAGCTATCCAGTTGCTAATGTTGAGTCGAGTGATGCTAGCGGCACA AATATAGAAAATGAAGAAGAGATTGATGAAATGATTGCGGTCTTACACGATATTATTACTGGTCATCACAACATGAGTTG TAATGATAATAATGAGAATGGGACAATGGCGGAGCCAGCGTTTAATGAAGATGGGGAAAATTTTGATAACTTGTTTGGTG AGGTGGAATCGAAATTATATCCTGGTTGTATAAAGTTCTCTGTTTTGACTTTTTTTTGTGAAGTTGATGCGTGTTAAGGT TCTAAATCAATTGACTAATGAGGCATTTGACATGTTGGTTGAGCTTTTGAAAGCAGCATTCCCTACAGCTAGAGTGCCGA AGTCATATTATGAGCCAAAAAAGATGTTGCGGGACTTGGGTTTGGGATACGAGTCGATTCACGTTTGCAAGTATGATTGT GCTTTATTCTGAAAAGAGAATACAAAATTGAACAATTGTTCAGTGTGCCATGAACCTAGGTTTCAAGATAAGAAAGGCAA AGGGAAGAAAGTTCCACACAAAATTTAGTGTTATTTTCCAATAAAACCTCGATTACAGAGATTATATAACTCAACACATA CCTCTGAAGATATGTGGTGGCACCACGATAAACGGCCCTTGAGAGATGGGGCAGCATGGATGCACTTCGATCAAGAATAT CCGACTTTTTCCAATGAGCCAAGAAATGTCAGATTCGGTCTTGCATCGGTTCAATCCATTTGGAAACATGAGCAACTCTA ATAGCCAACTCGTATGGCCAGTTATATTAGTACCTTATAACTTGTCGCATTGGAAATGCATGAAGGAGACGTCTTTTATG TTGACTTTGCTTATTCCTGGACCTTTGGATATGGATGTTTTCCAAAAACCTCTCATTGATGAACTTAAAGAGTTGTGGAG TGGTGTAGAGACAGTTGACATTTTGGACGGTAAGACATTTAACTTGCGTGCCACTGTTTTGTGGACTGTGAATGATTTTC CAGCTTACAGTTACCTTTCTGGTTGGAGTACAATAGGACATTTGGCATGTTCTCCATGCAACAAAGAAACATGTTACGAA TAGTTAAAGAGTAAGACTTGTTATGTGGGGCATCAATCTTTCTTACCTCCTGATCATAAATACAGGAAAACTAAACAGTA TGGCGGCATAAATAAAGATAAGAGTGCAGCACCTACGATATTGTTTGGTGATGAAATATTAGTGTAATTAGAACAGTTAA GATCTCGAAGGCCGAGTAAACATCCAAAGAACGCAGATAAAGACCTTAAACGTTCACCTGAGGAACTGAACTGGACAAAG AAGAGTATCTTTTTTGAATTGGAGTATTGGCCGAATCTAAAATTGAGACACAACCCAGATGTAATGCACATTGAGAAAAA TATATGTGACAATTACAAGAGAAATACTTTCCTACGTTGTTCAAAAGTCATCATGTAAGTGTTTTATTTACTTAAAGAGA TTATTGTAAGTTCATTTAAAGTTATAATGGTGAAATTAATTTTTACTATTTATCAGATGATAAATCTACGTGATGCCGGG TCACCTGAAGCAACCGATGAGCTTTATGCATTAGCTAATTTTCCAGATCGAAGAATTCACTCGTATTCCGGATGCATGGT GAATGGAGTAAAATTTCTTAAGAAAAGACATGATGACAAACGAACTACACAAAATAGTGGTATTTGTGTACGATCCTCAC ATGGAGATCGTGAAATGGATTTCTATGGCGTTTCGTTAAATGTTTACGCATGAGTTAAGATATAACAAAGGTTGCAGAGC AATATTGTTTGATCTTGATCGGAGGAGAAAGAGAATAATATACTCAGCATAAATACGAGTTCTGAATGGTACAAAACTGA AGCTTTCGGCCTTGCGACACAAGCCCAGCAAGTATATTACATGGATGACATGAATAATCCTTCTTCTTGGAAAGTGGTGT ATAAAGTTAATCATCGTCACTTGTGGGATGTTCTAAATAGAGAAAATGATGTCGATGAATTTAATCGTGATGAAATATAT CAGAAGATACATTGATTATTAATCCTTGAGGTTGTTGCCATTGATTCTATAGAAGTAGAAAGAAGAATAGCCTCTAAAGA GGATGATTATTTCATTTGTGATGATTTTAAGGAGGATCAAACACTTGAAGATTAATTATGAAAGTGAGGAAAGGGTACTT AGTAACAAAGATACTGATGATCCTGAGCACCATATGCAAGGAAATCATGAGGATGGTGACTGATTTGTAAGTTATTTCAC AATAGTTAATTCTCGTTACTTACATTGCAACTTGCAGAATTTTATTCTTATTTACTGATTATTTCACATAAAAAGGCACA GTTTACGTTATTTCCTTTAATAATAATCTCTTTCTTTGTTTCATGAGAAAATTAAAAAAAAAAAAAAAAGTACCGGTATG TATTCCACTAATTAGTGATGCTTTTAAATTACATTTTTAATATCCCTAACAGTATTTTTGTCTCTCTTGAATTTAACAAG AAGTAGGACTAGGAAGTGAGAGAGAGAGACTTTCACTTTCGTTTGTACATGAAGGTTGCCTTTTCGGCCAAGTTATTCCT TATTTTTTAAATTTTATATTTCTCTATTTGATTAATATTCTGGAAGGTTGAGTTTCTGATTAGAGTGGCAGTGAGCTTTT TTTTTTTTCTTTTTGAAGGAAAGATTATACGTCTTCTCATCAATCTTTGTTTATAATAATGTGTCAGAATATTATTATTG ATTTTTTCATTTCTGTTAATTAATGGGTTGAACACAACCCGTTTATTTGCTTTCAATATTATTTGATTTGAAAAAAGAAT AAAGATTAAATCCTATGTGAGTGTGTCTTATTTATACATGCGGCCATAAAATTTCCAACTTGATTGATTAGTTTATCTTA ATTAATTTTGATGTGCATTTTTGTTAATTTTCCAAAATTAGAAACTTGGAGAAGCTAAAACACCCTACAATAACGTCACT AATTTGATGCTAGTTTGGATTAGGAAGAAGTGGCATTGAATATAATATATATACATGAAGCCTTATTTTAATAGACCTGA GGGTAAATTTTGATTAGCAAAAAAAAAAAAAAACGTTATCAAATGAAATAGATAGAATTTTCAATTTATTGTGCATAGAA CATAATTTACGCACGTTGCTGATATTTAGGACCTATATATGAATCTAAATCAAGTTAATGTTGATTGAAATGGAATCAAA ATTCATCCAAACACAAATCGTATTCCTATATATCTATATATATATATATTTGTATAAGTGACCATGCTATATGTTTGCTA AATGATTTTATTTTCCTTATATACACGTGGTCTTTTTAGGCATTCTAATTTTAAGTTTGTTTTTATATCACTATCGATAA TTATTTAGGCAAGTTTGAATTGGAGTTAGAATGGGTGGGTGTAGCACTCATTCAGGCTAGGGTTAATCCTTAACGGAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAGTAAAGAAACGAAAATATTGTCGATCATTTTCTAGTCCCAATGATATTAAAG AACGCATAAAAATGAATTCCATATCTTTTATTGAGATATAATATTTTACACACATATATATATATATGATATGTGTGTGT TTGCCGCATGCATGTATGCATGTATGTAGGTAAACGAATTGACGTTTTAAAGTTGATGAAATCCAAATCATCTCTCAAGC CAAATTTAAAAGAAGAAAAAAATAATAATGTGTATGCATATGTGTGCGTGTGTATAAATGCCAACCATGATAACAGAGAT GTCTCTTCATTTTAATTGCAATATTTATCTTGTATTTAAAACAAAAACAATTATATCTCAAACTTTGACTTTTAATTAAT GGATTGACATTTTCACATTGAATTATTTACGTAGTGTCTTTCAAAAAATTAAACTTAAGCGCAATTTTTTACCTTTACAT ATAACGATATTTTCACATCAATTAAAACCCCCTGAATAAACCAAAATTAAAATAAACTACTTTGTAAACTCTATTACTAT GTTACTTTTAGTTGCTTTGACAATAGAAGAAAAAGAATATAAATAGATCTACGAAATTGAAAATAGATCATTAAAGTTTA ATAAATATAGATATATTGTATATTTGTTTCAAGACTTTTGTTTCATTCACGCCCTCCTTAAAAAACAAATTCTAGATGCG CCATTGTTTTAGGTGCACAAATGAAAAGTAAAATAATAATAATAATAAGAATAATAAAACTAACTGTCACAAGCAAGATA TAGATAGAATTTTCAATTTATTGTACATAGAACATAATTTACGCAGCAAATAACGTTGCTGATATTTGGGACCTATATAT GTATATAAATCAAGTTTATGTGGATTGAAATGGAACCAAAATTCATCCAAACACAAAAAGTATTCTTATATATATATATA TATATATATATATATGGGAGAAAGAGAAAAATAGGTCAAGACTTGAGATAAATTAAAATTAATAGGCCAATAGTTTACAT AAGTTAATAAATATGTCAAATTATTGTTTTCGTCCATAACTTGTCTGGTTATGAACCATAAGTTGACAAGTTATTATCCA TAATTGTCCATAACTTGACTGGCTATGAACCATAACTTGACAAGTTTGTCCATAACTTATCTGGTTATGAACCATAACTT GACAAGTTATAACCTATTAATTTCTATAACTAAAAATTGGCCTATGTGCTTTCTTAAGCTTTTCATATTGACCTATTTTC TACTATTTCTCTATATATATATATATATATATTTTGTATAAGTGACCATGCTATATGTTTTCAAAATGATTTTCTTTTCC TTATATACACGTGGCCTTTTTAAGCATTCTAATTTTAAGTTTGTTTTTATATCACTATCGATTATTATTTTGGCAAGTTT GAATTGGAGTTAGAATGGGTGGGTGTAGCACTCATTCAGGCTAGGGTTAATCCTTAACGGCGAAAAAAAAAAAAGAAACG AAAATATTTTCAAGAGAAATAGTATAAAATATGCCAATATGAAAAGTTTAAGAAAGTATATAGGCTAATTTTTAGTTATA GAAATTAATAGGTCATAATTTGTCAAGTTATGGTTCATAACCAGATAAATTATGGACAAACTTGTCAAGTTATGGTTCAT AGTCAGACAAGTTATGGACAATAACTTGTCAAGTTATGATTCATAACTAGACAAGTTATGGACGAAAACAGTAATTTGAC CTATTTATTAACTTACGTAAACTATTGACCTATTAATTTTAATTCATCTCAAGTCTTGACATATTTCCCTCTTTCTCTCT ATTTTCAATCACTTTCTAGACCCAATGATATTAAAGAACGCTTAATAATGAATTCCATATATTTTAAAATTGAGATATAA TATTTTACACACACACACGTTATCATTGGTAAAACTTTGAGACTATTAATATACATAATTTAATCTCCCAACTGCAAGAA CTATATTTTTTTATTAGTATCTAGATCTATAACGTTACTCTTATTGGCGGCTGACTTAATTTCATCATATGTTACTAATA TTGAATCGTATAAGATCAAATTCAATCTAGTAGATTTTGTAAGAAAGACATAAATCTCCCTTTAGATATAATAACAAACA GAATCTATAATTTACACAGATAGTTTGTACGTCATGAGCACAATAACATAAAAGTCGGAATATTATTAATGAACTTTTTA TTAGTTGATTCATACTAAATATTAACAAACAGTTTGGAACATAAAGTTCATAGAGATATAACAAGAAAACATTAACCACA CCCTAGCATAGCAAAAATTAATCCATATCCCATGAAATCAAAAAGGCAAATTCAGATCTGTAACGCTCTCTAGAATTAAA CATGTTTAATTATGTTAATTGTGTATATTAGTGTGCCTAAAATTAATTTTTTCTGATTAATCTTGTGATTAAAGATTAAG TTTTCGAGTTATTTTAATGAGTTATAAATTACTTTCAATTTTTCAATTTTCACCTCAAAAGTTTTTAAAAATACACTTAA TTTTAATGTATTTTTATTTATTTTTATTTATTTTTCTTTCTTTTCCTTTTCTTTTCTTTCTTTTCCTTTTCTTTTCTTTC TTTTCTTTTTCTTTTTTCCCCTTCCTTTTTCCCCCCGTGGCTGCCCAGACCCAGCCTCCCCCCCCCCCTCTCTTTCTTTT TCTCTTTTTTTTTTCTTCTTCTTCTTCTCTGGTTCTTCCAGCGCCCAGCCCTCTCTCTCTCTCTCTCTATTTTCTTCCAC CGCCGGCCACCTTCTTCTTCGGGCTTCCTCCCGCCGGCGTTCTCTCTCTCTCCCCCTCTCTCTCTCAGCAGTTTGGCCGA GAATCACCAAAAAAAAAAAAAACGAAAAACAGAGAAATTGAGGGAGACAAAGCTCGAGCAACTGATTTGAGGTCAAATCC TTTGAAACCCACTCTTTGATTCGAATTTAAGCTTGAGAAAGTTTTATTTTGGTTAGATTTGAATAATTTTGAGTTAGGGT TTGAGTTTGAACAGTTATTGTTGTAATTGAATGAAATTTAGGGGTTTTTAGTTATTGGACTTGTTTAATTGATTAGAAAC TGATTTTGATGGATTCTGGAGAATATATATTGAAATTGGACTTAAATTGCAGGTTTGGCATTTTTCCTATTTATGTCGGC ATGCTGCCGAAATTTCTTTAGAAACTTGTTTTAAAACTGAAATTAAATAGGAAAACCAAACCTATGGATTGAATTCTAAT TTTTAAAGAACCCCCAAACTGAATTATAAAATCATTGTGAAACTTGGATTTGAGTCAAGGCACACTAATAGGAAACAATT AAACATGATTGAACTTAATTCGTTTTAGGAATGAGAAATACTTCCTAAGATATTGCTTTTGTGATAAAGCTAGTGGAGAA GGTCAAGTATTAAGGCTTTAAGGAAAGCGGAGGCTAGGAGAACTGAAGGCTAACCCCGGTTTGACATCCGAGAGGTAGGA TATTATTGTCCATATCCTTGTTAGCCTCACTTTAAATGATTTTGGCTAATGAAAATGTTTTAGAACAAAACATGTTTAAA GAAAATGATTTCAAAGGAATAGCATGAGAATGCTATTAAGTTTTTCAATGATTTTGGAAATGAGATTTTAAAGAGTATCA TTTCTTAAAATGAAATACTTTAAGGAATGATACAACGCATTGTGGCCTCAGAGATCGGGATATGGGAATCGTATCCTTGG GGGTAGGTCCCAAAACCCGTACGGATCCACTTCTTGCTCAGTG