>DTC_16_1_Mno length=10010;Class=DNA transposons;Order=TIR;superfamily=CMC; CACTGGAATCTCCGGATAGACAATATACAGATCTTTATTTAGAACTTGAGTTGGAGTTGTTACCTGGCGTTTCTAAGTCA TCAGTGTTGAACTTCTTAGTTAAACTAATGCATTTGAAGGTGGATAACAAGTGGACGAACAAGTCTTTCGATTAGATGTT GAAGTTATGGAAAGACAATCTTTCAGGAATTTAACTGCCCAATTCGCATTATGAGGCAAAGAAGAAACCTAAGAAACTTG GTTTATGGTACGAAACGATTCATGTGTCCAAGTACGACTGTGTTGTTTTGGAAAGAGAATGCTAATCTCGAAGCATGCCC TGTACGTTACGAAAGTCGATGGGTGAATAAAACCGCAAAGGGGAAGAAAATTCCCCACAAAGTTTTGAGATACTTCCCTC TCGAGGACCGTTTGGAGCGATTGTATGCTTCGTGTCATACCCTGAAGGACATGACATGGCACCATCGAGGTCAATCAACT GAGGAAGGGTTGATGCGACATCCTGTTGACGGTAAAGCTTGGAAGGACTTTGATACAAAGTACCCAGAATTTGCAAGTGA CCCACGGAATGTGAGATTGGGCGTAGCTGCTGACGGATTTAAACCGTTTGGTAATTTGAGCACCCCGTATAGCATGTGGT CCGTTGTTTTGACCGCGTACAATCTACCTCTCTGGTTGTGTATGAAGCCTTTGTATTTAATGTTGAGTCCCCTAATTCCT TATCCAAAATCCCCTGGAAAGGATATGAATGTATTCTTGAGACCTTTAGTTGATGAGTTACAAGACCTATGGGCAAATCT AATTCTTCCTTCAAAATGTAGGCTGCTTTAATGTGGACTGTCAATGACTTCCCTGCTCGTAGTAGTTTATCTGGTTGGGT GGGTCAGGATTATCAAGCTTGTCTGAAATGTAATGCGGAAATACCGTTAAGGTGTTACATCACTAAGGTTTGCTATGTTG GTCATCGAAAGTAGCTTTCACTTGATCATAAAATGAGAAGCTGCAAACAGTTTGACGGTAAGATTGAAAATGTTCAACCC CCCGCCCAAAGACCAGTATAAAAATATTGAACCATCTTAGATATGTTCACGTCAGGTTATCGGGTAAACACACAAAATTC CGAGGTATGAGAAGGAAGCGCAACCCAAATGAGTTAATTTGGTCGAAGGTGAGTATCTTCTGGGAGTTGCCGTATTAGTC ATCAATGTTATTGCAACACAATCTCAATGTTATGCACATTGAGAAGAATGTATGTGACAGTTTAGTCAGAACTCTGTTGA ACATAGAGGGAAAGGCCAAGGATACAGACAATGCACGAAGGGATTTGAAGGAGATGGGCGTCAGAAAGGAGTTGCATTTA TTCAAGCATGGTGATCGATGGTTGAAACCGCATGCTAAATATACCTTAACGCCCGGGAGTGTGACCTAAAATGACTCAGC GACGTTCATCTCTTGCTTCTTCCTCCTCTGGAACACAGTCCGGGATGCCTACCGCAGGTTTAGCTCTAGATATGCAACAG TGGCTTTCGGTTTTACACACCAGTCATATGGAGTTGGTCAAGAAAATGATGGAGCTACGATGTGGAGTTGAGTGAACTGT CATTTCACCCCACCAGGAATTGTGCTTCTTAGGATCGATGAGGAAGATGATGAGGAAAATGTTAACTTAGGAGATTAGGA TCTTATTACAGTATCTTATCAAACTTGTACTGTTTTTATTTATTGTTAAACATTTAGATGTGTGTTTTATCTATTTGTTC TCTTATCTCACTATATGTTATTATTAGTACTATTATTATCCATCTAATTAAATTTCAATCTATTATTTAACGATTACATT TTATTTCATAATACCTATTATTATCCACTTAATAAGTAAGCTAAAAACAAAAAAAAACAAAAGCAAAAACAAAACAAAAT ACAAAAAATTAAAACTTCACAAAAAAAGTAAAAAAAAAAAAAAAACAAAATAGCGACGACAATTTTGTCAATATTTTTCA GTGCGGATAACTTTTAGCTAGCGACGAAATGTTGTCGCTAAAAGTGTTCCCCAATTTTTAAAATCGGACAAATTATAAAC TTTATGTGACGACTTTTTGAAAAAGTCAAAAAGTCGTTGATAGTTGTTCTGTCACTTCCGATCAGAAACTTTGATTTGGA AATAATGACGACTTGTCGTTGTTAAAAAAGTATTAGCGACGACTGGTTAGCAACGACAAGTAGAGAGAATGTTTGGTTAG GGTTTGAGATTTTGGAATCGATTGGAGAAAAGATAAAATTAGAAATAAAGGTCTCATTTAGTTGTCCAATTCGAGTTCGA ATCGGAGAACTGAACGAAGGGTAAAGTTAGCCTTGACAATCAAATTGAAAAATATTTATTTAAAAGTAAAATGAGAATAT GGTGTAATTTACTATCATTTAAAAAAAATGCTATTTACTCTAATATAGCTATGAAATATACTATATAGTTTATTTTATCT ATCTCTTTTTTTTTTTTTTCATTTTCTCTCTCTGTTTCTTTTTTTCCTCTAACTTTAGTGAATGAAATTGGATCTCAAAT CTTCTATGTCTGGGACCTTAATATATTTGATTAAACTTATTACTAAGGCACAATTACTTATATTACTAAGGCACAATTAG TTCTTCTAGATAAAGACAACCAAAAACAACTAATATTATAAAATATCCAATATTGCATTTTTTAAAAGAATATTCAATAT TAAAATTTTTTTATTATAAAGAATATCAAATATTACTTGTAACGCATTTGTGGCCTCCATTCATTGTTGAGATTTATAAA TATGTTGACAAAAATACTTATAAACATGTTGGCTACAAGTTGGCCGCCAAAGTAACTTTCATGTAAGCACCGATAAGTTG TAACAAAAGTTGCTGCGCAACGTCACTTGATTTTCTAGCAAGTTGCACATGCATTTTCATATTTCATATTTCGTATTTCT TGACATGGGACTTGAATCCTTGATGATGTGATCTTAGTGGGACATTACGCGCGGGAATTTTGACTTTCCTATTAGATGTA AATTTTTGAAAAACTTTGAGAGAGTTTCTCAAATAAGTCGTAAAAGATAAATTAACAGTAATTCTCAATTTTCAATTGTC AGAATTAGTCAAAATTACATCAATTTAAAAAAATATGCAAGATAAATAATTTTTATTATAGATCTGACGTGACGTCTTGG AACAGAAAATCATCAGTAGTTCATTATTTTTAGACCTACTAGAGAAACTATTAAATTTTTATTATGTCTCACTTAAGCAC AAGAGTTTTTTTTTTTTTTTTTTTTTTTTTTTGGTAGATTTAGAAAAAATGAATTACCGAAAAGTTTATATTTTCAGCTA TCAGGTCTATATAAAAAATTATTTATTCTGCATGTTTTTTTTTTTTTTTTTTAGAATTTTAATCATATTTCACTCGTACA TTTGCGTTTTATATTGTGTCTCCACTGAAAACTTTCTACATGAATGTCTTTCTCTCTTGTTCATGTGTTGGTACTCGTTA TGGTATTCTCAGAAAGTGAAACTTCCATGTTTTTAATTGCGATTAGTACCTAAAGCTCCTATGTATTTTTAATTAAGAGC TCGTTTGGTTCATGGATTAGAATCATGAGATTAGAACGATTTTTGATTTATGTGTATTTTTTGTGAGAGAAAATACTGTA GCGAACTATGAATCATGATTTGAATCAGAAAACGAATCCTCCAACCAAACGGGCTCTAAATGTCATGTTTTACCTGGTAT TTTTATAAATGATATGACCACCTCCTGTGTTTTTTTTTTTTTTTTAATTTCATGTTAGAAACCTCAACTTTGAGCAAAAA TCAATCGTACTTAAATGTGAAAAAGGCGATTTTAACAGACTTCAACACCTTAAATTTAACTAATTCAACCCAATCTTGTG ATTAAAATGATCTTTCCGTACCTTACCTTCGATCAAAAGTGGAGTTTTTAATATGAAACTAAAAACACAAGATTTGGTCA CGAAGCAGTAAATGACGTGGCATTTCGATAAAAAAAATAGAGAGTTTATAGACTCATCCCTTTTTAATTAATATTGACAG TCCAAGTGTCCAACACATAATTTGAAGTTTTATGAAGATTATTGCATATTTTTAAGAACATTGCATATTTGTATTTGCAA TATTGCTCTTAATGAGAACATTAATTTATAATTGGGACTTTTCAGTATTGGCAGTCTGCGTAAAATTTTTATTTTAATCA AACTTGCCATTATATAAAAAAATTCTTTTAATTGCACTTATTTTATTACCGAATCAGTACGTAATGCCATGCATCAAACG TAATAAAGCAATTACAGCACTAATAAGTAGTAATTGGATTAAAGTAACTTTCTAATGACCAGCATGAAATGTACTTGTCT GTGGCAAAGAGAATTATACATGCAAGTTTGAATAAGAAATCAATTTTTTTACATTTTTGAGTTAGGGTGACTTGAGTGAT GATCTTGAGTTGAGTTGGAGTTATTACTTGAGTTGAAGTTGTAACTTGAGAGTTTGTGTTTAGATGTGCACATTTACGTT ATGATTTGAATTGAGAATCTATTTGAGTTTTTGTTTAGTGGGTCAAAATTTAAATTTAAATTTAGATAGTATTTTAATAA AAACTCAATGGTGATGAAAAATTTTAGTAGGGTATATGGGTGGGGTGTTATTCGTCTTTTCGTTATGAATGCATAGAAAA AAAATCATCTCAATCAGAATTAAAACGAAAAAGTTATAGTATTTTTAATAATAAAAAAAAATAATGTTCATTAATTTGAG TTCGAGTTTATGAACTCGAGTTGAAGGGAAAACTTGAATTCGAGTTGAAGGGAAAACTTGAACTCGAGTTTAAATTTGAG TTCAAACTCGAATTTAAACTCATTTTACAAAAGAACGTGAACTGAAATAAAATTATAACTTGAGTTTAATTTTTTTTTAA ATTTTATTGTAAAAGAACAACCCAAAAAGATGTTGCCCTTTGCCTTTGTTCTACTAATAATACTTCTTTATACTACCTTT AGTTCACAACGATTTCTTTGAAAACCGCCGTCAAAAGCCTCACCAAAAAACTATGCTATTGAATTTTTTTTTTTTGTTTT TTGTTTTTTTAGAAAACATAATAAAAGTGGCAGATTCTATGCTAGCTTTCCGAACACTGCCGTAAAAATGTCAAGATTTT CCCCAGAGAGAGAGTATTTTTTCCTTCCACCAGTTGTATTTTGAATTTTCTCTTAAGTCTGATTAAATCTTTCTCTTCCT CATTGCACAGCCCGATCACCATCAACGTCATCCAACATCCCTAAACGTTATCGTTGTCCCTCCTGGGCATATTACATAAA AATTTATAAAATGTTTAGCTCATGAGTTCAGAATCATAATTCATAATTTTAATTTTTAAAATTTAAATTATTTATGAGAA AAAAATACCGTAGAGAATCAAGAATTATAATTCAGAACCCAAAACGAACTCTTAAAACAAACATGCCATTAAATTTTTAT TCAAATCTAAGAAGTAAATGGATTATAAATCTCCACCGTTCTTGACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA ACCCTTGCCTTCATTGTGAGCCCGCCATCTAGGATTCGAGGTTAGCGTTTTCCATACAAGAAATTAAAGAAAAGGAACCT TTTGCACAACCAGAACAAAGAATTGGACCCTTCTTGCAAAAAATAAATTTCATCCCTCGAGTACTTGACGAGTAAAAATC AAGTTTCAAATGCGTTAAACTCCATCAAGTATATCAGATAGCATTATCCTTGGTTGCTTGGAAGGCTATAAAAAGAGTTG CTTATTTTCAACAAACTAGTTGGTAAAATCACACTCTAAACTATCACAATTTACAGTATACATTTTGTGGAAACCCTTGA AGTACTTTAAGAGTAGTGCATAAACGAAAAAGAAACTGAAGTCGGAACATAAAAGATACATTGATGATTAAACTACTCGA AGACATATAGACGGTTTGGCGATCAATACAATTCGCAATATATAATCTCTAGTTCCTACTCTGCCAATAGTCGGAATCTG GATTGAGCGGGTAGAGATCATGAGCCGATGAAGAAGAACCAGTCCACGGTCCTTCAATTGACATACTGTGTGTCTGACTG TCAGCATGATTTCCTTCTTGAATGATTTGATTATGTTTCCTCATCACGGAAATATCATGAATTGAGACACTCGTATCCTG GATCAGCTCCTGAATGGCCGTTTTGCCTTCGAGTATGCTCACCACAGACGACATGGTAGGCCTAGCGGCTGCAGAGACAT TAGCGCAGAGGAGGGCCACATTGATGGTCAACAATACTTCTTCTTTGTCATAGTCCGAGCCTAACCTCGGATCAACTAGC TTGATTAAATTCCCTTCCTCTTTTAGAAGAAGTGCCTAGAAAGCAGAAATGACAAACAATTTAGTTGTAATAAAAATCCA GCCTCACCACACAATGAATCTTTCAATTTAATTAGGACTGCCAAAGACTCAAAATGCAGTTTTAAAGTTTAAACATTGTC AGAGGAAGAGCAAAATACATGTCTAAGGTAGTTATATGAACAGAATTAAATCAAATTCTATCAATCAAGAAGAATTGAAT AGCACTAGGAAGCAAATTTACCCAATCAAGAAGATAAAAGCAGTCGTCCTTTAAACGGTAAGTAGTGTTGCCTTTTCCAC TAATAATTTCCAAGACAACAATTCCGTAACTGTATACATCTGCCTTATCGGTTAAGTAGCCGCGCATTGCATATTCAGGT GCCATATATCCACTGCAAAACCATGGGTAACCATTAGATATGCTGATAGAATTAGCAAGAATTTCATTAGTACTGTGATT ATTTTCAGACTCATGCTTCAACTGAAAAACAGAACAGCTCCCACATTTGAAGAGAGAATCAGATCTCTTTTGCACAAGAC TAAATTACTTAACTCTTTTCAAAAAGTTGTTTTCTAAAACACTCATATGGTTGAGTAAAATTGGTCAAGATTTCCCATGG GATGGAGATTAAGTGTGGAAAACAAGAAACAAAATTAACAAACAGGGACTTACTAAGTTCCAGCAATTCGGGTGCTTATG TGGGAATTCTCCTCTTCATCAAGCTTGGCCAAACCAAAGTCAGATATCTTAGGATTAAGATCTTTATCAAGAAGGACATT AGTAGACTTGATATCTCTATGAACAATCTTCAATCTTGATTCTTCATGGAGATAAGCCAAACCTCTTGCAATACCAACAC ATATCTTTCGCCTTGCTGGCCAATCTAGTTGTAACTGACTCTCCTCAGGACCTATAACGTTTCAAACCAATGCAAGTAGA AAAATATGAACATTTATTGGGTGCGAAACAAGTTATCCTAATAGGGAAAACCAAAAACCACTGAATATACACAGGCCATT TTACCGAATAAAGCACGTGCAACGTTGTTATTTTTCATGTACTCGTACACAAGCAGCAATTGGTCGCCTTCGATACAGCA CCCATAGAGCTTAACAAGATGAGGGTGTTGCACAGCTGAGATCATGCCTATCTCATTCAAAAATTCACGATTCCCTTGCT TTGATTTGGAAGAAAGCTGCTTAACTGCAATTATGGCGCCATCATATAGAACACCCTGCATTTGAGAACACATCCAAAGT TCCTTCATTTGAAGAAAAAACAAAATCTTAAGGAAGAGACACAAATTGTAATTAGCTCCAATCGATAATGAGCTCCAATT GATAAATGTAATTAGGATCCTAAATGCCAAAATAAAAAAAGTTCAAGGTCCAAATTGTCAACCAACAAAAAGTTTACAAT GCATTTTGTGCAAAAATTGTTGGACATTATGTCCACCAATTGATGTCCGTTTTCTATCGGACGTTCATTAATAAAAGATG TCAATTAATTAATGAAAATTTGTAACGACCCACACCCCCACTTAGTATGATACTGTCTGCTTTGGGCCTGAGCCCGCACG GTTTTACTTTTACGCCTCACCCTAAAATGTCTCATACTATTAGTAGGTGGTGTCATTCCTTATAAACTAGGACCTATCTT CATCCCCAGACGATGTGAGACTATACAACTTACCCTTTCTTGGCCTTGTGCCTCAAGGGATTGATGACTGTCACAATCAC CCCTCCTTATGGGGGCCCAACATCCTCGTTGGCCACATTTTCGGCTGGATAGAGTCTCTGATACTATATGTAATGACCCA CACCCCCACCTGGTATGATATTGTCCGCTTTGGGCTTGAGTCCGCACGGTTTTACTTTTGGGCCTCACCCCAAAAGGCCT CATACCATTGGTAGGTGGTGTCATTTCTTATAAACCAGAACCTATCTTCATCCCCAGGTGATGTGAGACTGCACAACTTA CCCTTTCTTGGCCTTGTGCCTCAAGGGATTGATGGTTGTCACAATCACCCCTCCTTATGGGGGCCCAACGTCCTCGTTGG CCACATTTCCGGCTGGGTAGAGTCTCTGATACCATATGTTACGACCCACACCCCCACTTGGTAAGATATTGTCCGCTTTG GGCCTGAGCCCGCACGGTTTTGCTTTTGGGTCTCACCCCAAAAGGACTCAAACCATTGGTAGGTGGTGTCATTCCTTATA AACCAAGACCTATCTTCATCCCCAGGCGATGTGAGACGGACAATATTATACCAAGTGGGGGTGCAGGTAATTACATATGG TATCAGAGATTCTACCCTACCGGAAATGTGGCCAACGAGGACGTTGGGCCCCCGTGAGGGGTGATTGTGACAACCATCAA TCTCTTGAGGCACAAGACCAAGAAAGGGCAAGTCGTTCAGTCTCACATCGCCTGGGGATGAAGATATGTCCTGGTTTATA AGGAATGACACCACCTACCAATAGTATGAGGCCTTTTGGGGTGAGGCCGAAAAGCAAAACCGTGAGGGCTCAGGCCCAAA GCGGACAATATCATGCCAAGTGGGGGTGCGGGTCGTTACAAAATTAGAGCCCCAAATGCAAAAATCGTAAAGTTCAAGGT TCAACTTGTTAGCCAACAATATGTTTGAGATGTATTTTGTGCAAAAATTGTGGGGGCGTTATGTCTACCAATTGACGTTT GTTTGCTATTGGACCATAATTGCAATGGATTCTTAAATTTAGGATACCATTTGTCAAAATTGAGAGTTTGGGGTCTAAGG TACAAAACACTAATAAGTTCAGGGTGCATGGATGCAAAAATCTCACGAAATAAAACATCCAATGCTTGTGAGGAATACCT TGTAAACAGGACCAAAACCACCTTCTCCAATCTTATTGGCTACATCAAAATTGTTTGTAGCAGCTTTGATTTGCCTCAGG GTAAATTTACCAGTTTTCAAGTCCACACCCTTTAGATCTGTACAAGAAGTAAACTGCTTATAAATAAAATATTTACTAAA AGCCTTGGCATTCTTGACCTTTTGTTGCAAATCTAAAGACCGGCGATGCAGAAAATACTACTATATCCATCTTGATTAGA TAAGATACTAGCATGTATATGATTATCCATACTAATGTTGATGTATGCAAGATGACAGCCACAGTTACTTGACAATACTT GACAAAATTCTATTACTGTCGTCAAAATTACCTTGCTCCAAAGTAGTTTTCCGCCTTTGGCAGCATTTCCTCCAAAGGAC ACCGATTATGAGCAATACAACAAGCAATGATCCAACGACGATTCCGACTATTGCACCTACAGATATGCTACTTCCAGTTT CTGTTGATGTGGATGGAGGTTGAAAGTCTGCCAAAGGAAGATAATAGTCATATTTAACATTGGAAGCTGCAGCATTATGT GAGGAAAATGTATTTCAAAATTTAACAACATTCCCATATTTTTTTTTCGTTCCAAAAAAAATTGACTTTAATTATCTCTA AAACAAAATGGTCACTTCTGGATGTTATTGCATTGAACTTGAGATATAATCACTCTACAAAGTAAGACATTAGGAAAATA CATGACAGTG