>DTC_15_1_Mno length=7865;Class=DNA transposons;Order=TIR;superfamily=CMC; CACTAGTTCACTCAGGAATAAAATGTTCACATAAATGATTATCAAAGCGAAGTTGATTTACTTAATTAGAGTTATCGTAT AAATCAATTTCACTTTAAATCTAGTCTAATATATATGAATTTAATACATATATATTTATATATTTCTCTATTTAGAAAAG TGCATTCTAATGTGTTAGGATTTGTGCCCTATAAAATTAATACATTGGATATATTTTAGACATGTTTGGTTAATAAAGAA TAATGTATTTATTTCATGTATTAATGTGTCATATTTATGTTCATTATATTATTAGTATGACACACAAACCAAAGTACTTT AGGGTATCAAAAATATATTATTTTTAACGTTAAAGTATCATTTTTGATATTATTAAAAAAGTAAAGGTAAATTTGAGATG TTTCGATATAAAATAGAGTATTAAAATGAATTTATCCTTATATGTAATGATCTTAATTTTGAAGTGGGTTCATGACTCTA TATTTATAAGTCTTTTGATATACTAAAAATAATATTTTCAATGGTGATAAATTCTCACGCCGATATGTTGGAGGCATGAT TTATAAGGTGAAAGCTTGATAAACATATAAGGAACTATAACAATTTCACCGAGAGTTAATATTATCATCTTAAAGGTATT ATTTGGGAATTAGTAAAACATATTGAGGCAAATGATTCTCTAAGTATGTGTGTTATAAACAGTGATTTCCCTTTGGTAAA TAATGCAACTTTGAGAGTTCCGTAATATGATATATAATAAAGAGTTCAGCTTCAAACTTTTAATGGATTAGCACCAAAGT TGATAATCAAATAGAAAAATTAATTGGTGATAAATTTATTTGTTGCTATTGTAGCTTGATAAACATTTGTGCTCATTTAT TCTTATGAGCACTTTAGATGGAGAAAATTAAATGGTTCTCTTTAGTAATTAATTTTTCGTAGCCCTTGAGTGGCTGGGAA GAGGCAGTATCAATGTTGAAGAAAAGCTGAGTTGTCTTTATACACAATGATCTGTCAAAACGATAACAGTATAGAAGACT AGTTGGTTAAAGGCTTTTTCAAAATATTTTATTATATGTGTTTTCTCCCATTCTTCAGAGGTAATAAATTATCATATTTA ATTTATTGTTCATAGTAATTAAAGTTAGATGTCTGATAAATAATAAAACTTTAAAAATTTTACTGCCTCACTCTGATTAA TTTTTCCAACATAATGACCAACATAAACCATCTTCTTATTGAGATACACACACATTACAATCTTATCAGCAATAAAGTGC CCAATTTTATTTTATTGATTGCAGACTTTAATTTATACTGTTAACTCAAAATAATATCCTCTTGCATATATCATCATATA TGTATATATAATTTTAAAGGATTAACAATTAAAGTGTTGGTGCTTTTTTTTTTTTTTTTTTTTTTNNNNNNNNNNNTTTT AAATTTTAAAGGATTAAAAATTAAAGTTTTGGTGTTTTTTTTTTTTTTTTTTTTTTTTGCGATAAACTTTTTACCATCAA ATCATGATAGTAACTTTAACAATCAATGTAAGAAATAATCCTTTTATCATACAATAAATATCATGGGTATATAAAATGTA TATGCTCTAGGGCATCAATCCCATCACTATCTAGTTTGAAGAGAATGTGGTTATCTATAACAGATTTTGGGAAAGATGGT GAATTTGTATAAAATAATGAAGTTAAGGATTGAAGTGTAAATTTTGTTATGTTAAATAATATCTGTAACACTAGTATACA TAGTAGATATGATGATGGTTAAAAATGTTCGTCAAATAGTATGTCAAAACACAAAAGAAGATGATTTTTAACCATAATTG AATATTCGCGTATAATATCATGTGATTATTGATTTGGCATTTTTAACAAATTATCCTAAAGACCATCATCAAATGTGTTT AAAATTTGAAATATATATGTAATAATAGAAAATTGTGTCCTCGTTATAGCAACAATTTCTTTCTAGTTCGCCAATTAGAA AAAAATATATATATCATTTTCTTAACACAACACAAATAACAATTTCTAATTTATACGAGAAAGGGCATGTGCTCCACACG TGGTTGTTCTTCCTTTAAATTGTATATTAATTGTAAGCATGTGATACACCCCTAAATATTAGTTTATTTTTAGAATTTAT TAATTAGCGGTGATAAAAGAAATAGTTAGTTAGTTAGTTTTTGTGCCTATAAATATGTAAGCCATCCTTGGCTAAAGGGG GCATGAATGAAATGAATTAGTTTTCCCTTTCCTTCTCTATTCTCACTAGCCCTTCCTCTATTTTTCATTTATTGGAGTTT ACGCTCACTCGAAGAGCGATTATCCGATCCGGCCACCGGAATCCATTCCGAGGGTCGTATCATTAGTGCTTTCATTGAGA GATGACGATGATATCGATGGAGCTTATCGGCAGCGATGGCTTCGCAGACTATTTCTTAGTTATGGAAGCCCTTGGTGATG GTCCATACACGGCCAGCTCAATGGTACGAAAGCCTAGACTGCCTACACTTTCACCGGCGCTGGCATCCCTGAAAACGACG TCCTCCTTCGACAACAGCAAGACAATTTTGTCTACATAGTTACCACCCAAGGCAGATTCAACCACAAACCAGCCACCACC ACAATCTGGGCTCTCAGAATCACACGGGCCAGCATTACCACTCACCTTCCCATGTTCAGCCTTCACTCCGAGTATTCGTC AGCCAAAACCAGAGCCGATCAAAATCAACTCAATCACAACAACTCCGATCTCCATTGATCATCCACCACTGTCGAAACCA CAACCCCATACGCGACCAGGAGAGACCAAGAATGCCACCACCACACTTGCTCGGTACTCGAAGCAAGGATCAGATCCGTG GCCGCCAGATCCTTCTGATATCGTACCTGATTCGATCTTTCCCAAAGCAAAGCCAGAAATTCGCCTCACATCCAGGTTTC TTCACGCCCTCGAATTCTGAATCAGTGGATATAGAAGGAATAGGCGAATGAGTTTTGTGAAAGACCGAGGAAAAAAAAAG ACGTATCAAAAACAAGATCGACGAAACGGAGGTAAGAGGCGGAAGAACATAATATGCGAGCGAAGCCAAGCTATGATGAA GAACGGCAATGAACGCAAGGAAGCTTGGTCGCGAAGGATTGCTCAGGGACGGTGACAGCCGGGCCTTGTCGGGGCTGCAA CAGCTGACAACGGTAAAAAAGCCCGGGAATGCATCGGCGTCAAGATCACCTGGGTTGCGAGGACGGGGAACGACGGAGAA GCCCGGGAATGCATCGGCGTCAAGATAGCCTGGGTTGCGAGGACGGGGAACGGCGGTGAAAGATTTTCACGACTCAATTT GGGGAAGAAGAATAAGCCTCCAAACGACCTCCTTGGGTTCCAAACGACAGAGTTCTTGCTTCCATAGTCAGACATCCAGT TGGGCTCTCCCCTGCTCTTAATGGGCCTCTGCTGGCTTGGGTTTTCTCAGGTCATAGTAGAGTATAAGCACGAGGAGGCT AAAAGGATTAAAAAAATAAATAAAGAAAAAAAATCAATATGCTGAAGGGATTATTTCTTTTTAGTGTTTGAATTAAATTT TTTTTTTTAACCACCTTGAGGACAAGGTGATTTTGAAGGGTTGGGGAATGATACACCCCTAAATATTAGTTTATTTTTAG AATTTGTTAATTCGCGGTGATAAAAGAAATAGTTAGTTAGTTAGTTTGTGTGCCCATAAATATGTAAGCCATCCTTGGCT AAAGGGGACATGAATGAAATGAATTAGTTTTCTCTTTCCTTCTCTATTCTCACTAGCCCTTCCTCTATTTCTCATTTTTT AGAGTTTACGCTCAGTCGAAGAGCGATTATCCGATCCGGCCACTGGAATCCATTCCGAGGGTCGTATCAGCATGCTTCTT TTTTTAGTTTGTTTTAGAAGTATGAATTTTGTTCTTCAAAAAAAAATGTAGGATTGTTGATGAAAAGAATTGATGGATAA GTTTTAATGTATCGGAGTTTTACAGTGGTTTATATCTCTTTTCGATTTTATTCTCATTAATTTGAGATTTAAAGTACGTA TATATGTAAATCAAAATTAAAATAAGAATTAGTAATTGTTTCATTAACTATTAAAACAAAATGTACACTGATACTTTTTG TAGAGCATCAAAAAGGAAAAGAAATAGTTACATAGTACAAAAGTATGATGACATGATATATGTATATGTATATATTATTG TGTAATATGTTATGGCCTGACGAATAAAGAGTTGATTAAGGTGTTATATACCCAAATTTGAAAGTTTTGCAAAAAAAAAA AATATATATATATATATATATAATTTAATTTTGCCACGAGAAAGGAAACATTTATTTATTTATTTATTTATTTGCTAATC TAGTTGAATTCAATTGGAGGACATCGATTCAGGTAAAAAAAACTTTTAGGCAAGATCACATCAACTTAAAGGAGTAATCT GCTAAATGATTTTTTTTTTCAAAAATAAATGTTTTCTTTCTGTAAATAGTTTTTCCGCAAAAAAAAAAAAAAAAAAAAAA AAGTTATCGAATCATCGTCCTTTTATTTTTTGTTATGAAAAATTACTTTATACGGGGGCCATAGTCTTAATTATTATGTC TTTTCCTTTTCGTATATCATCTAATTAATAAAAATTTTGTAGTCTTATACTTTAATAAAATTTTGAAATACTCTTTTTTT TTTCTTTCCTTTCTTTCACATTGCAACTATCTATTTCTTCTTCTTTTACTCAATGTCTTACATGTTTTTTTTCGAGGGAT ATGTAAATATTTTTTAGTATTCTAATTTTTAAATGCAAAATGTTTTCTATCGTGCTTAGATATTTGTATTATATTAATCT CACATTATTCATTGCAACAATCTAGTTCTTACTATTTATTAGCTTCGGAGGTTACAAGCATTTATGGATAAAAGTTGGAT TCAAAATCCCAACAAATTGTCCGATGAATATAAGAGCGGTGTGAAACAATTTCTTGAGCTTGCTGTGAATCACTTAGATT GTTAGTTTACCAATTCATCCCAAAAGCTTAAGCTGTTAGGAGGTGGACCAATAATAGTTTTTATAATTTAACACTCTCCC TCACATGTGGGCTGGATAATAGACAATTATGTGGATAAATTAATTGGAAAACCCAACACGTAAATATTTAAGCCCGAAAT ATATTAAAGACCCAACACGTGATGATAATTTTAAATGGGGATAAAGAGTGCAATTACGGGGGTTTAAACTCAGGACCTCC CGCTCTGATACCATGTTAGTTTACCAATCCATCCCAAAAGCTTAAGCTGTTAAGAGGTAGGCCAACAATAATTTTTATAC TTTAACATGGATAGTCATAACAATGCACGTTGTCCTTGTCGGATATGCAATAACTTTTATTATCGAGATAGTCATAACAA CGTTTGGTGCAAGGATTTGCCAACAATAATTTTTATACTTTGGATAGTCATAACAATGCACGTTGTCCTTGTCGGATATG CAATAACTTTTATTATCGAGATAGTCATAACAACGTTTGGTGCAAGGATTTGCTAAGGATTGCGTAAATTGGATTTATCA TGGGGAACCTATAGAAACCAACGTGTTTCAAGTGACAGTGGAACTTAAGTGAACGTGTGGTTCATGTATTCAGAATCATG ATGCAGAACTATTCTCATTTTACGTGTGTTTTTTGTGAGAGAAAAACACTATAGAGAACCATAAATCATGATTCAGAATC AGGAACGAATACAGAAAACAAACATCCTAATAATTCTACAACAATCACTGATGATGATCAAGATGAAGTTATTCCAGCAT TGGAAGATGCAACTGACCAAATAAATGTGGATGATATTTGAAAGTGAAAATAATACAGCTAATGATTGTTTATAGTGGAC AATTTGGCAAGTTGTTTGAAGAAGCCAAAAATATGTTGCATTTTGAATGTACAAAATTTTCAGCATTAACCTTTTTGATA AAGTTAATGCACACTAGGGTGATGAATAATTAGAGCAACAAATCATTTAATGTGCTACTTGGATTGTTAAAAGATGAATT TTCAGAAGCAAGAATCCCTGCTTCATATTATAAAGCAAAAAAATGTTGCGTGATTTGGGATTAGGGTTTGAAACTGTCCA TGCTTGTAACTATGATTGTGTTTTATTTGGGAAAGAATACAAAGATGCCAAAAAGTGTCCAGAATGCAGTGAGTCAAGAT ATAAGTCCGATAGTGGTAAAGGAAAAAGAGTACCTCAAAAGGTTTTGCGGCATTTTCTATTAATTCCAATATTAAAACGT TAAATTCATGTCGAGACATACTGATATTGATATGAGACGGCATAAAGAAAAGCGTGTCAATAAAGAAGGCGTGTTAAGGC ATCCGGCAGATGCTGGAGAAATGAACAAGCAATTTTCTTGGTTTGCAGCAGATCCTCGCAATGACAGATTATCTCTTGCA ACAATCGGTTTTAATCCATTTGGAAAGATGAGTACTTCATATAACGTGTGGCCAGTTGTTCTCGTACCATATAATATGCC AACTTGGATGTGTATGAAAGAGACATTTTGTATGATGACTTTATTGATTCTCGGTCCAAATGTACCTGGTAAAGATATTG ATATTAATTTAGGCCCTCTGATTGATGAATTTAAAGAACCATAGGATAAAGATGTTGATACTCTCTTGATGCATCAACAG GAAATATTTCAAATTTCATGATTTTGCGGACAATAAATGATTTTCTAGCCTATGAAACCTTATCTGGACGGAGTACGAAA GGGTACTTGGCATGTGCAATTTGTAACAAGGACACTTATTCTAAACGATTAAGGAGTAAGATTTGCTATAGGGGACAACG TCGTTATTTGCGAAAACATCATACTTTACGAAACAGTCAACAACATAATGGTAAGATTGAAAGGAAGTTAGCACCAAATT AGATGCTTACTGGAGATGATATATTAAGGCAATTAAGTCAACTACCAAAATTAATGCCAGGTAAACATCCATAAAATCCT AATAACAATGAAACCCCCATTGAGTTGAATTGGACGAGAAGATGTATATTTTTTTAGTTTGACTATTGGTCAAAGCTTAA ACTCAGGCATAATCTAGATGTAATGCACACTAAGAATAATGTTTGTGATAGCCTAGCTGGAACTATATTGGGAATAGAAG GAAAATTACAAGACACTATTAAGGCACGAGATTTAGAAGACATGTAAATTTGAAAAGAGTTGCACCTCCAACATCATGGT GGTCGTGTTTTGATCCTTCACCGTGCTTCACGCTTTCACGAAATGAAAGAATTAAGTTTTGTGAATTCTTAAAATCTGTG AAGTTTCCAGATGGTTATGCCGCAAATATCTCAAGAAATGTCAATGTAAACGAAGGAAAGATATAGGATTCCAAAAGTCA TGATTTTCATATTTCACTACAACGCCTCTTGCCAGTTGATATCGCACCGTATTTGAAGAAAGATGTGGTGAGAACTATTG CTAGATTTTCTAATTTCTTTCAACAAATATGTGCAAAAAAATTGTTCATCAAAGACTTGGATACATTGAAACAAACAATC TTCCCTCCAGCCTTTTTAATGTTATGGTAAATCTTCTTGTGCATTTGCCATATGAGGCGAAAATGGCTGGACCAGTCCAT ACACGATGTATGTATCATTTTGAAAGGTATAATTATTTAATTTATTTCTTAAACATCGAAGTTTATAATATAATTGTAGT TAACTTTATTCTTTTAATGCTTCTTTTAGGGTTTTACGAACATAAAAAAAGTGCGTGAAAAATAAAGCTCGACCAGAAGG TTCCATTTCAGAGGCATACGTAGTG