>DTC_14_1_Mno length=7745;Class=DNA transposons;Order=TIR;superfamily=CMC; CACTAAAACATCTTTCCAAAATTTGCTAACGCTTTGTTCTATTCACTAATTTAGGGCCCGTTCACTTCGCTGATTCGAGT TTAGAATTTAAGTTGAAATGTGACTTTATGTGAAAACTTTTTACTGTAGTAAAAAAATTAGATGTGATTGTTTGTGAGAG CTTTTTACTGTAAAAAAACTCAAATCAGCGAAATGAACAGATCTTTAAACTGTAATAAAATTAAAATTAAAAATTTAAAT CAATAAAATGAACGATGTTTAAATCTCGTATTCTCTTCACTCTCTTATTATACGTCATATATGTCCTCCGTAGCATTTAA CCTAATTTGGGCAGAAGAAATTAGGGATTCTTTTGTAATCGGGGATTTGGGATTTTCTCCATCACTACCACCTTCGTTCA TTCGCCACTGTCACTTTACATCCCGTTGTCGTCAGCATTGGTGCCTTTGCTGTCATTGCTCACTTCAATCTGCTACCTCC ACTTGAAAACCAACCGGCCGCTCGTGACTATCCCCAACCAAAAAGCTTCGAAATCCAATGAAAAACTTTGACGTAGGTAA GCTTTGTATAGCTCTCCGATCGACTTTAATAGGTAAGCTTTAAACTCCTAGGCCAGGGTAAATTTTAATTTTTCTCATTT TTTTGTTTTTGATGGGAAAACGTATTTCCTATTTATCTATTTCAATCATTACAAGAGCAAGAGCATATATATAGGAACCC TAGCCAACAAAAAATAGAAAATAATCCCGGATTTGTGTTGAGAAATCTTCAATCGAATCAAGAAATAAATTACAAGAAAA AAGAATGGGGTAGTAGATTACCCAAATCCTCTAAATAAGGAAACTAGTGAAGTTGTAATATTATAGTTGTAAATTCTTTA GTCAACACTATAATTCCAACTCTCCCTCAAGTTGGGCCGTAGATATTGATCACACACAATTTGAAACTCAAGTCCTTAAA GCTAGTTCTTGGCAAAGCCTTGGTAAGAATATCCGTTGTTTGAAGTCCTGTTGGAGTGTACATGAGAGTGATAGTTCCTT CCTCTATTTTTTCTTTGATGAAGTGACGATCTATCTCCACATGTTTAGTCCTTTTATGATGGACCAGATTTTTGGCAATG CTTATGGCAGCTTGATTATCACAGAACATTTTCATAGGAGTTTCAATTGGAATTTTCAACTCCCCAAGTAACCATTTCAG CCACATTCCTTCAATAATTCCATGGGTCATAACTCTAAAATCTAACACTACACAACTCCTAGCCACTACGGATTGTTTCT TGCTTCTCCGGGTAACTAGATTCCCCCACACATAGGTACAATATTGTCACGCCCCCAAACAGGGATTGGTGACATGGATG CTTGTTTAGAAATTAAACACTGATTAAGAAAGTAATTAAGCTAAAGTCAAAGTCAAAGATAATGTATATATAAGAATTTT CAAACAAACCCTACTATTTTAAGGAAATTGAGTTTTAGAAAAGAGTGAGGCGGACTTTACAAAAACCACAATCAGAGTCA AATTAATTTCAAAAGTCAGCCTCTGGCATCCACAGGGTTTCCACATTGTGCATACATAAACAATACATAAAAGTAAATTA CAGACATCAACCACAGTCTAGTAAAGTTTAAAGTTAAAATCCATAATTTATACATGCCTTAATACACGTGGCAATGAGGG AGGTAAATTATAATTTCTTCACTTCTGGAGATCGGCTCACCTCACCGGCACTCACCACTACTTCTAACGTCGCTTGAGAG GGGTTTAATACATTTAAAACAGAAGAAAAGTGAGCGAAAGGCCCAGTAAGATATAATTTTATAAAACTGAATAAATAAAT GAAAATACATGGTCTGAACATGTCATCCAGAACCAAACGTCCATTTTTTGAAAGGAAAATAAACTTAAATTTCCGGTTTC AGGCATTATCAAGTAATTTATAAGTTAGGATAAATTACTTACAAGCATTGCAAGGCCAAACACCACCGTAGTGAGCCGTA CGAGTTTCGGGTCCTGCCTCCAAGGATACGATCCCGATCTCTAGGCCATCAGCGTTGTTACCATTTCTTAAAATATCTCA TTTTAAAAAAATATCATATAAAACTCTTCTTTAGATTTCAATAATTTCAAATACATTTTTATCTTTAAAACGTTTTCATA GGCCAAACACATTTAAAACAGGCTAACAAGGATGTGGACATCTTACCTCACGGATGTCAATTCTACGGATAACTTCAAGT AGTCCTAGCCTCACTTGTCTTTGAAGCTTCAAGTCTTATCATGCCGCTAGCTTCAGTTTAGAGTTTAATCATTATCTCTA AATAATCTAGCTTAATTATGTACAATTGTATCATATTAGTGTGCTTTGACTCAAAATCAAAGTTCATAAACAACTTCTTG TTGGTTTTCGAATCGAATTCGGATGCGGAAGCGTGAGGATAGCGGATCAAGTATAAAAAGAAATTTCATAAAACATTTGA GATACTCTATAAATTATATTAATTTATGCACGTATAAATTAATCACATTAATTTATTTATTAAGAACTCAATTAGTAATA ATACATGGAGGCCGATTAGGATGATAACCTGAGTTCCTTGACCTCGAACAATCCTTGCTCCAAAGCCTTGTGTTTAAAAA ATCAATGTCTTTCACGTCAATTTTTAGAATCCATGAAGATGTGTGTGTGGGCACACCTGAGACAAAACGGGTTAAAATAA GCACTCAAATTTTCACAAACACCAACGCATGCACGATGTGGAATTTGACTTACCCTACGGCAGTACTCAAGAGTTAAGTC TACAGAATCTAAAACAGTGGGTTACACTCATAAAATATAATTACATAGTTAATTATATTTTTAATCAAAATAACGATAAT TAATATAGATTGAATATATGAGATTTTTTTATAACCTTATTAATTGAGAGAGTCTTGGTCTAAGTTATCTCATTTACTTG TTTGACAAGTTATCCAATTAAATTTAAAAATAAATTAAAGTCTGACTTTGTTTGAATTTGAATTTAAATAAAAATCGAAA AAAAAGACAAAAAGAAAAAATTTATCTTTCTTCTACACTATGTAGGGCACCACCCACAAGGGATAAATAACTGTGGGGGC TGATTTCTATAAGGAGAGAGCAAGACAATTTTGTTTCAAAATTAAATGGGAATTATATTTTTATTAGGATTTAAAATATA AGTGATAACCAATTTTCTATTGCCATTATAAAAAAATTATGATTTAATGACTCAAGATAGATGATAGTTTTAATAAAACC GTTATCTACATTTCCATTTAGAGTGCGGACATTTTTATTTGAATATTAGACAAGGGTTTCTTAAGAAACCGTTGTCCAAT ACTTAAATAAAGACGAAGGTTTATTTTTAACAGTCGTCTAAATGTTCTTTTATCTAACACAGGTCACGCACACTTCTCAT TTTCCCAAAAAATACACTGAGATATCTCTCTCTCTGTGTGCAACTTGCGAACCCAGAAAATTAGAACGTCGATCAGTTGT CCTTGCTCGCCCATCAACACGCCGACACATCTTTCGTGGTCCACCTTCACCGTTCACCGTCACTGCCACTCTTCATTCCT CCAAGCTAGGTACATCTCTCCTAAATCTTGTTTTGTTTGGTTCAGACAATATTTTAAGCATTAATTTGTTGATTTTAGTA TTACTTTGTAAAATTATGAAATATTTGGTTGGATCACCTTGAAATTAGGTTAGATATGGTTTGGGTTATAGTGAATATTA TTTGGATTCTATGTTATGATAATGATTGGGGTAATGTAAATTGGTTATGTATTCGGTAATGTGATTGTTGATGTCTCGGA TTGTGTGGTTGAATTTTAAAATTGTTTGTAAAATTAATTTGGGTAATGTGTGAATGGAATGAGATATGATTTCGCTTGTG AATTAATTGATAAAATTATTTATTTAAGTAATGTGATTGTGGTTAAAAGTTTAAATTGTTTATTAAATTTATTTAAGTAA GGTGTGAATTGAATGTGATCATAATTGTATTGTGAAATTATTATTATGAGAATATAATTAAAAATTTTGTGTCTATTATT TTGGTTTTGTGTAGCAATAGATAGAAAATGGATGTATGCAAATAAGATGAGTGATGAATATAAGAGAAGGGTTGAAGAAT TTGTGTCATTTGCAAAGAATTCCACGAAAGAGAATATGATTCGTTGCCCGTGTGTGCAATGTGGAAATATTAAGAAATGA TTAATAGATGATCTTAGATTTCATTTGTTCTAATATGCAATTGATCGAACTTATCAAACATGGATATGGCATGATGAAGA TGTTCCTACTTCATCATCGGTGGTTAGGGGGAATGATGATGTTTATATGGATCATAAAGAAGATAGTAGTAACATGGTTG AAATGATGAACGATTTGGAGGAAGAAATTTGTCAACTGGCCATAGTTGTTTGAAAAGATGATGGATGAGACGGAGACACC GTAGTATAATGGGTGTAAGAAGTATATCAAATTGTCCGGTTTGATTAGATTGTGGATCTTGAAAGCATCGGGTGGGTGGT TTAATGCAAGTTTCGTGGGACTTTTAGAATTTCTCAACAATACACTCCCGAATAATAATCAAGTGCAGGATAGTATGTAC GAGGCTAGGAAGACATTGAGCTATGGGGATAGAGTATGAGAAGATACATGTGTGCTCGAATGATTGCATTCTATACCGGA ATAAGTGTGCAGACTTGGATGAGTGTACGGTGTGCCATGAGTTTAGGTGGAAGAAAGGTAAGAAACCGTCGAACGGAAGA AAAAGAGTGCCGATGAAGGTGTTATGGTACATTCCAATTGGACCACGTTTAAAGTGATTTTATAAGAATACGGAGCATGC AAAAAATTTAACTTAGCATCATGATATGAAGTTCGATAATGGCATGCTACGATTTTCGGCCGATTTTCCATAATGGAAGA CATTTGATCTGGCGTATCCTGAATTTGATGCGGAGCCTAGAAATGTTCGCCTTGCTTTTTCGACCGATGGAATGAATCCT TATAGTAATTTGAGCAGGAAGCATAAGACATTGATGTCTTCTGCATGAAGAGGAAGTTCGTAATGTTGACCTTATTGATC TTAGGACTTAATCAACTGGAAAATGACATTGATGTCTACTTGGCACCGTTGATCGACAAGCTAGGGAGCTTGTGGGAAAG AGGGATCAAAGTTGAGGATGGTTTCCATCAAAAGACCTTCCACTCCATACAATGTTGATGTGGACCATTAATGACTTCCC TGCATATAGAAGCCTATTTGGGTACTCAGTTAAGAGTTCCATAGGTTGTCCCGTTTGCATGATGGAGACATATTCTATCC AGTTGGAACACAGAAAGAAGACGGTTTATGATGGTCATAGGAGATTCATGCCTATGAATCATCAATAACGCAAACGAAAA AAGAATTTAATGGTAAGACTGAAGAAAGACTACCTCCAAAACCGTTGATACGGAAACAAGTATATGAGATGATCAAGACG TGAAAGTGGTCTTCGGGAAAAAGAAGGAAACAAATAAGGAGCTAGTGATCGGACCTTGGAAGAAGCAGTTAATTTTCTTT GAGCTTCCATAATAGAGTTCACTGTTCCTTCGTCATTGTTTAGATGTCATACACATTGAGAAGAATGCTTGTAAGTCAAT AGTTGGCATGCTACTTGACATCCCCAGTAAAACTAAAGACAGCCTCAATGCATGGTTAGATCTCATAGAAGTGAACATTA GAGGTGACATGGCTCTTGAGAAAATAGGCTCCCACATTTACTTACCTCTAGCTAAATATACACTATAGAGACAAGAGAAG AAAAGGTTCTGTAAGTGGCTTGCTTCGATCAAAGTTCTAGAATGGTATTCTTCTAACTTTAAGAATTTGGTGTCGGTGAA GGACTTAAAGATTATTGGAATGAAGATGCATGATTGTCACACATTGATGCAACAGTTGTTGCCATTTGCTTTGCATGGAA CTCTAACAAAGGAGGTTAGATATACACTTACCAAGTTTTGCTTTTGTCAACTCCATATGCTCAAAGATACTAAATACAAT GATATTTGATACAATACAATCAAAGTTGGTGAATACCTTGTGCATGCTTGAGAAGTATTTTTCACCATCCTTCTTTGACA TCGTGATTCATCTAATGGTGCACTTAGTTCGTGAAGAGAGACTTTGCAGACCGGTGTACTTGAGGTGGATGTACCTATTT GAAAGATACAAAATCCTATAAGATTATGTCAAAAACTAAAATAGGCCAGAGGATTGCATTCTGGAAAGTTATATAGTTGA AGAAGCTATTGAATTTGACTCGTAGTACTTATCTAACGCAGAAGCAATAGGTTTACCTAAGCAAGTAAACATTGAATCCA AAAGTAAATTTGCCACTACTCCTTCGTTGGTTCCTCGCGAAGTATGGGAACAAGCTTGTTTCTATGTTCAACACTATACT CGTGAGTTGAACCATACATCGAGGTGCACAAAAAGAAAATAAAGGCAGCATTCCTAAAAGGAGGAAAAAATGAGAAATTG TTGCAAAATAAGCATAACTGGACATTTAGAGAGTGGATAAAGACAGACGTTTACTCTAAGGTTTACGAGCCTCAAAATGG TGGCGTCTCTCAAGTCATGTTAAAGCACTCAATAAATGGCTATACCTTCTACACTTACGAAATAAATGAAAAGCACCCAC TCTAAAATAGTGTTGTCAATCTTCTTGTCGATGCTATGTATGTTTCCTCTACAAAAGACCAAAATCTTATATATGGAACA ATGACCTACTATGATTTTATCAAGGACATATGAGAACTTGACTATTGTGGATTGTGAGTGGCACTTTTTAAATGCAATTG GGTCGACAATAATCATGTGAAGGTTGATAGCGACAGTGCTGCAGTTATAGACATTCATTGACTAGGCTACAAGAATGAAC CCTTTATTTTGGGAACACAAGCAAAACAAGTTTTCTATACAACCAATCCTAAAGATTTAGAGTTGTCATTGGTTGTTCCT ATGAAGCCAAGAGCAATTTGTGATGGCGAAGGAGATGATGACGATTGCACCATTGGTTACTAGAGGATTGCCACCGGTTG ACGAGGTTGATGTTTTTGAAGATGATGATTTCACTTAATTTGTTTGGATGTTGAATAAACATGTGTTGAAAAAGGTAATA ATAGGAAGAGAAAAAAATGATCATGTATTTATATGTACCTTTATGAACATTTAATTTATGTGTTTGTGAAATTACAATTC ATTGTGTACTATTGTCTTATTTAGTAATTCATTTCATCATGTTATTTTTTAATTTACTTGTTATTTGGTTCTATTGTAAA TTTTTATTAATATTTGAAATAACGTACTGAAATTAAAGAATTGTGATGCCAAATAACACACGGGATATAGGCCACCTGTG GGACAAGCTGTAAAATATGCATGACTTTTTTGATACTGGAACGACATATAACGACGATTTTTAGTAAAAACTGGCATTAG AAATAAACATTCAACGACGGTTTCTACAAAAAACCGTCGTCTAATACTTTCATGGTACCGTCGAATATCATATTAGACAA CGACTTATGCATAAAACCGTCGTGTAATGAAATTTTTAACGACAGTTAAAAACCGTCGTAAAAGGTCGTAATGATTCGTC TAACCATCATCAAATCATATTACGACGGTTACTAACCGTTGTAAATAGTCATATTTCTACTAGTG