>DTC_13_1_Mno length=4003;Class=DNA transposons;Order=TIR;superfamily=CMC; CACTACAAAAAAAAGGCTTTTTACGAGGACTAGAATGGCGAGGACACATAGTCCTCGCCATTAGCCATTCATTTTACGAG GACAGGACCATGTCCTCGCACAGAAAAGGGGCCAAATGTCCTCGCAGAACACTAACAATTTCACGGGCCCTGCACGAAAT AGTTTCGTGCAGGGCTAATTACTCTTCTGCGAGGACATTGTCCTCACAGAAGAGTGTTTACGTCAGAAATCCCTGTCATT CCTGACCGCTTCAGTCTATCAAAATCTTCTGCAAGGACGTTATCCTCGCAGAAGAGTGTTTAGGTTAGGAATTCCTGTCG TTCCGGACCGCATCGGTCTGTCAAAGTCACACCCTCATTATTCGGCAAGGCCGTTCATCCTCGCTAAATCCCGTGAAAAA ATGTCCCTCCTTATCTTAAGTTTGCAGCAGTGAAACGATGTCGTTTCAAAACAGACCCTAATATGTTCAAAACAAAACAT AGATTTTCAGAGTTTCTCCTTCTTCATTCCTCTCTTTCTTTGCTATAACAGAGAGAAATCCGGCCGGCAAATGTGCCCAC CTCTTTGTAAGAGGCCCTATATCCTACCATCTCCAACTCTCTCCTCTCTCTCATTTCTTCAACTCTCTCCTCCCTCCCTT TGTTTGCTCTATATCCGGCCAGCAAAGAAGAGTTTTTTTGTGTATTGTGTTCATTTTCAAACTTTGTAATCTCCTCTTAT TCTTTATCTCATTGAAGTTCGAATTCCAAGGTAAGTTTAGACAATTTATTGAGTTATATTTTGTGTTTTTATATACATTT TGTTCATTTTTATTGTTCTAAATTGTGTAGTTGGATATTGGTATTTTAGGTGGTAAAGAGGAAATCCGAATTTCTCCTCA TTTTCAGGTATGATTTAAATTTTATTTATGGTATTATTTGTAATTTATTATTTTATGTAAGATATTGTTTGTGTAATTTA GTATTGATTTGTGGAAAACCATTGATATTATATTTTGTTAAAATTTGAGTTTGTGTTATGATTTTAGGTGTTGAAATTAT ATTTTATGGAAATTTCCTATTGTGTTTTGATTTTAGGTATTTAGATTACAAGAATTAAGGGGGAAATGCTGCTGAAATTT ATGCGTAAACGAAACGAAAATGCAGATAAATTGACTAAATACGCTAAGAACGCGCACAAATAGGATAGGGCTTAGAGTTG GAGCGATAAGGTGTAATTAGAACACTTTGTAAGAATATGCATGCATTTGATGATCATACATTGTTGGATTTATTGACTAG TATGTTTTGTTTAATAAGTAATTTATCATCATGACAATCGACAAGAGTTGGACAAAGTTGAGAAATTGTACGTGTAAGGA ATACATGGACGGAGTTGTGGCATTCTTGGAGATGGCTTAGAATCACGTAAACGAGAAAGGACAGATAAGGTGCCCATGCA ACAATTGTGTGAATTATTTTTGGCATACATTAGAAGAAGTTGATGCTCATATAATTCGGAAAGGGCCGGTTTGACCCATT TGATGATGTCTGGAGGTATCACGGTGAAGCTGAAGTCGATATTCGAGTAAATAATATAGTTCATGAAACTGATGAATCGC CAGACGAGATCGTTGACATGTTACGAGACATTACGGGTCCTAGTAATTTTCCACAAAATATTGATCATAACTATGACAAC TTTGAGGATGATATTACAATGGGGCCAATGGAAGGTGGCAAGTACGATGAACTCTTCGCAAAAGTTGAAGCCGAATTGTA TCCCGGTTGTACGAGCTTCTCATCTTTAAATTTTTGACTAAGTTAATGCACTTGATTAACACTTGAAGGTACTTAATAAG TGAACGAACAAATTGTTTGATTCGTTGTTAAAGTTATTAAAAGAAGCTTTTGCATTACGAGGCTAAGAAGCTAATGAGTA AATTGAGACTAGGGTACGAATCAATACATGTATGTGAGTATGATTGCGCTTTGTTTTGGAAGGAAATGATGGACTTGACA ATTGTCCAGTTTGCAGAACGAGTCGTCGGGTGGATGGAAATCAGAAGGGAAAAAGGTGCCGCGAAAAGTGTTGCGATATT TTCCGTTGACTCCGAGGCTGCAATGATTATATGGGTCTAAAACACATATAATCAACGATCTCGTCCATGGAAATCAGAAG ACATGAGATGGCATTATCAGGATTGATCGAAAGATGATGGTGTGTTGCGACATCTGGCAGATGAAGTGGCTTGGAAAGAT TTTGACTGAAATTCCCTAGGTTTTCACGTGAGCCGCGTAACGTGCGCTTAGGGTTGGCAGCAGATGGTTTTAATCTTTTT GGTAATATGAGTAAAACTTGCCTTCATGGTTATGTATGAATGAGTCATTTTTTATGTTGACCTTATTGATACTGGTTCCC AATCCCCAGGTAAAGACATGGATGTGTTTCTAAGACCACTTGTAGATGAGTTAGAAAGAGTTATGGTCTAGGGGAGTTCC AACACGTGACACAGTTGACAATACACTCTTCAGAATGCGTGCGGCCTTGTTGTTCACAATTAATAACTTTCCTGCACGTA GTCATCTCTCAGACTGGAGTGGACAGGGTTACAAAGCATGTCCAACCTGCAACAAAGACACACTATCGATGCCTGTTTGT GGCAAGACGGTATATGTGGGTCACGGACGTTATCTACCAACGGGACATCATTTAAGAAATAGTAAAGATTTTAATGGTAA GACTGAGAGGCGACACCCTCCTCCTCGGATATCTAACGAGGAATTATTGGAGCAACTTAGTCGTGTTAGATACAGATTAC CTGGAAAGCACAAAGAATATGGGGGAAAAAGAGAAAACGAAAGGATGATGAACTAAACTGGGCGAAGAAAAGCATATTTT TCGAGCTTGAGTATTGGTCTTCGTTGCAACTCAAACATAATCTTGACGTTATGCACGTTGAAAAGAATGTGTATGATAGT CTGCTGGGTACAATTATGGGCATTGAGGGAAAGTCAAAAGACACGACAAATGCAAGACAGGATTTGCAGAACTTAGGCAT TCGAAGCGAGCTTTGGCTGAAACAAGTTGGGAACAAGACTCTAAAACCACAAGCTGAGTATACTTTGTCACTTGTTAACC GAAAGAAGTTTTGCAGCTTTATTAAGTCTGTCAGATTTGCAGATGGTTTTGCTTCCAACCTTCGCAAGAATGTTTCCGAG TCTGAAGGTAAGATCAATGGCCACAAGTCACATGATTATCACGTCATTATGCAACGGTTGTTACCGGCAGGTATTCGTCC ATATATGAAGGAAAAGATATACTCAACAGTTGCAGAGTTGTCTAATTTTAATCAATTGATTTGTTCTCGCACATTGCATA CGCAAGTTTAGAGGCGGCTCAAGAGAATATAGTGTTAATTCTTTGCAAGTTAGAACGCATATTACCACCTGCATTCTTTG ATATCATGGTCCACTTAGTAATGCATTTACCAGAATAAGCAATTCTCGGTGGTCAAATGAGGTGGGTGTATCCATTCGAA CGCTACTTAAAGAAACTTAAAGAGTTTGTACGAAATCGCGCACGGCCCGAAGGCTCTGTAGCAGAGGGATATGTTGTCAA CAAAGCATTAACATTTTGTTCAATGTACATGCGTGGTATTGAGACAAAGTTCAATAGACACCAGAGAAATCAGTTGTCCA GATCTGATACAGTGATGAGAAAGATATCTGTCTTTCAGTCTAATTGTCGTCCAATAGGGAAGAAAGATGTGGTCGTTCTC GATGAGCGTCTCAGAAAAGTGGCAGAGTGGTACATCCTCAACAATTGTCTAGAAATCCGGCCCTACATTGAGTAAGTACC GTTTCTTCTTTGCTTACATTTGATGTATCGAACAAAATGCTTGTGAAAATACTTGCTAATTAAGACGCATATTCCGTAGT GAACACATGAGAGAAATAGAAGCCGCGGGTGTTGAAAATGTGAAAGTCTTCTGCGAGGATGACGCTCCTTTATTGTTGTA GTG