>DTC_12_1_Mno length=15191;Class=DNA transposons;Order=TIR;superfamily=CMC; CACTACAAGTTTGGGAGAAATGTATTCCAATTGTGCACTTAATTCTGGACCTGATGGAATTGTATTTCCTCAATCTCTGA CTTTGCTGCCATACACTCCAGCCAGACGCCACCATCCTAGCCCCGCATGTTCTACACCTCCTCCTGTTTCCAATGAAGAT ACTGACTGACAACTACTCAGGGAAGTCCTCTACACTCTTGTTTTACTTTTCCATTGAGGACAATGTCAGTTTTAAGTTTG GGGGAGTTAACTATCTTATTTATGTTATTTTATTCAGTTTAAAAAAAAAAAACTGAGCTTTGGTTCGGCTTGTTTCACCC CAGTCGATGATGAGACAACGATTGAACTTAACTATGGCTTCTGAGAGACAATGAATAATTTGATTGTTTGTGTGCTTGAC TTGTTTGTTGGTTTTACTCTACTTATGATTTCCTTGCATTGTTGAGCACATAACTAAGAGCACTTGGCCATGTTGTGAAC TTAGAGAAAGTTTATGTGAATTTCAGGTTTCTTAAGATCTCACCAGACTCTAGAACTTGTTTGATTATCACTCGAGGTGA AATCCCAGGCAATTTATCACTAAGAAAATGATTTAGGCCATTTTTGGATCGTTTGAGCCGTTTGAGCTTGCCTTGTTATA ATAATATCCCTAGTTACCTTTTTGAGCCTGATTAAACTTTTCTTTGTCATCCACATTATTAGCTTAGCCTTTAAATAAAT CCTATCATTCACCCTTTCCCTTGAGCTTGTTGATTATTCTAGGATGCACGTTTAGTTGTTTTTAGAATTAGGAGGTGTAT TGATATTTTCTATAATTTGTTTGATGTCTCCAATGAAATTTTGTATTTGTCGTATTATTCCAAAAAAAAAAATTTGAAAA AAAGAAAAAAAAAGAAAAAAAAGAAAGAGAAAGAAATAAAGAGTGGAGACAAGAATGTTGATGGCAAATGGCGGATGTTT TGAGATATTGAGTTAGAAGTTCTACAAGAGGATCCTAGAGTAATTGATGAGTTTAGGGAATTTAGAGCCTCATTGATATC CTTTTATCCTACCTTAATCCCTAGCCATTCAATTCAAGCTTAATAAAGTCTTATTGATCCTTAGTGCTTTGTTGACCGAC ATTAGTGGAGAGTGACAAGAAAAGCAAGCCTATGGAATTCAAAAAATTCTCTTTACTTAGAGATCTACCTTGATTCACTT AATTGCATAAACCCATCTGAGTTGCATTTGGGCATGTGAATTGATAATTCACACACACACACATAAGAAGTCCTAGGTGG GGGTGGGATTAACATTCGAGTTGAAATTCTAAACTTTTAAAAAGTTTAAAGTCTTTCTTAAGCTGTAACTTATGTGAGAT CTCTGAGGCATTTTTTTTGTGAAACAACGCCGGATCAATACTCAAGCAAGGTTTCATTTATTTATGTTTCGTATTACTCG TGTTTTTACTTTTTATTTTTTGTAGTTTTCTTTCTTTCATTTTTGTTTTGCTCGAGGACTAGTAAAATATTAAGTTTGGG GGTATTTGATGAGTGTGTTTTACTCACTCATTTAGTATTATTTTACACTTAATATCTAGTTAGTTTTTGAGGCTTTTGTT AGTTTTTATGTGTGTTTTGGTTCTTTGTTTGAAAGTTAGGTGAAAGTCTATGATTTGGAAGGTTTTGGACAACTTTTGGT GGAAAAAGACAGCAAACATAGCGCTTAGGCGCCAATTTCTAGCGTTTTGGTGCTAAGTCTTACAGAACCAATACAGTTGG ACAGAATGGGTAGCGTTTTGGTAGCCATGATAGCGTTTTGGCGCCCATGATTTTTGCACAGCCAGCGTCGCAGTGCTAGG AACTCAGCGCCGCGGCGCTACGATGCGAGAAAAGGCGCGTTTTGAAGGCCAATCCTGAGAAAACTTACTCGTTTTAACCC TAATGCTCCTAAACATTCAAATAGATGATTCTAGGGCAATTAAAAAGACTTTTGGACTGAAGAGTGACGGCTGAATTTTG AGATGAGATTCAAGAAGAGAGAGAATTGAGTACCGAGAAGAAAACCAAACTCCTAAATACTAAGACAGCTGTTAACAAAA CAAAGACTTTTTCAGAATAAGTGTCGCAACACACATAATAGTTTTGTTATATGACTTTCGTATATTCTTCCACTCTTTGA GGTTAAACAACTGCCTCTGCTTCTTATTAAATAAGAAACTAAGAAAGCCATACCGGTTAGTCTTGCAAATGTGTATATAT ATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNGCAGCTTCTTCAGTCCGGCCGCCGTTTCCATTCGGCCGGACGTGCCCACTTCCCCAGCCTATCGTTATCATCCCA TTCTCCCCCCTCTTTAGCTGCATCAATGTATCCCCTTCTCTCACACACAGATGGAACGACTCCTTTTGTGATTCATATAT ATATATATGCAGCTTCTTCAGTCCGGCCGCCGTTTCCATTCGGCCGGACGTGCCCACTTCCCCAGCCTATCGTTATCATC CCATTCTCCCCCCTCTTTAGCTGCATCAATGTATCCCCTTCTCTCACACACAGATGGAACGACTCCTTTTGTGATTCAAG ACAAATATCGATCCTGATGTAGCGTAAGCTTGATTAAATAAAAAAATGAAATAATAAAATAAAAGGGTAAATATGTTGAT TCACACAAAATATCAGGAAAATTACTATAAAAACTGTTGATTCACATAGAATACCGAATTTGGGAAGAGAGAAAATTCGA GAAAAACTCTAAAATTTTATTCAACTGAAATGGTCTTCATTATAAGATGACGTCCATATAAATAGGTGAAACAGAAACAA GAAGCTAACCTATTCTATAATTAAAATAATAAAAAATACGAAATTTTCCAATAAAAAAAGGAAAATTATGAAGTAGAAAC TAAACTTGAAACTACTAGACGCAAGGAAAAAGAAAACACAATCGACAATAGAATCCGAATTTCCTAGGTCAACTTATTAC AAAAACAGAAATTACTAAAAATGGAAAAAACTCCCATTTGGAGGCCTAAACAAAGGAATTTGCCCAAAAAATGTGACACA TCGTGTCAAAGCGACAAGTTTTGTCCATTGGCCCGTTTCCTTTCAGAAAACAAATTTTTTTTCATCCAAATATGACATTG TCAAAAGACCTTAAGAAAATAAAAAATTTACCTTATTTGACTTTGGAATGTTCTCAACGCACCCAAAAGACTGGTTCCTT CTTTACTGCATCAATATCCCATTGAAAATCGCTTAAATCAACCAAGAAATCAGCTTTACTTAAACGTTATATGCTATTCG CAGACTTCGAAGAGACCCAATAAATTCTTTTTGTTCAATTTAGATTTTTCTTTTTGTTTTTATAATCTATTTTGTGTGTG TATTTGGCTATGTTGGCTTTAAAATTATACTTAAATACATATTATTTACGTTATTTTTGATATCTTAAAATTGAATAGGT CACGATATTGTTTTCTTATACATTTTCTAAGACAATCGATTAAAAAAAAAAAGCTTTGCTAGGGTTTTTAGTGAGAGGTG ACAACTCACCATCTGGTGTGAGCTTTTAAAGTTTGTAAGAGGCTAGAGAAGCTACCTTTCAAGTTTCTGTTATAGGTTTG CTGGTTTCTTTTTATTTTTGGTTGAATAAAAGCATATATTCTTCAATTGGTTCAATCTCTCTTGCAGCTAGTAGCGTTTA TAAAAGCCTAGAGAAACTTCCTTTCAAGTCTGTAAGGATACATGCAAACTCCCTTTGTTTCTGCAGTACATTGCTCACTT ATCTCAAGGTCTATACTTTTCTATTATCCTTTTATTTGGTTCTCAATTTATGTTCATTTTTGTTTGGTTGGTTTCTTTTT ATTTTTTTTAACTGAATAGAAGTATAAGAATGTCGTAGTGAGTAACATATTTCAGAATTCAGCTAGACTTTAATATATCG TCTCTACTAGTTAGACTATGAATATGTTGTTTCTGTCTCACTCATATGCTTTAGTTATCATGTTTCCTAATGTATTCAGT GTATGCGTTTCAACTTCACTTCTATTGTACTGCCTTGTACAATTGAAAAAAAATAATTTTGTTGATTTTTGTAATCTATT TAATTATGTTAGTTATTTTAATTACATATTTTTTATCTTTTACACTTTTATATTTTTTTATTGTATATACATTATTTTAA TTAAGTGTCTCACTGGTTCTTTTTTTTTTTTTCCACCCTTAAAAGACTTAAACATCCATTAGTTTCTTTACGAAATATGG ATAAATGTCCATGCACAAGATGTGGCAATCTGAAATTTCTTAATCGTGGTGAAACAAAATACCATTTATTTTGTAATGGC ATTGATAAGAGTAATACAAAATGGGTATATCATGGTGAACAAGGAGACGACTTGCCTCATAAAAGGGATAGAAGGGAGGA AAAGGTATTCGATGATTTTAAGGATCACCCTAGAGATATAGTTATGGATGCAGAGGATTTACGTGTGGATCCTGATAATC AACCTAAAGAATTTGAGAGGTTGTTAGAAGATGCTGAAACACCTATCTACCCAGGTTCTCGAAATACAAAATTATCCGTA TTGGTAAGGTTATATAATGCAAAAGCTCGACACGATCTGAGAAATAAAAGGATTTTCAGAATTTCTTTCTATAATAAGAG ATATCTTGCCTGAAAAAAATGTGATGCCTCAATCTTCATAGAAGGCGCAGAAATCTTTAAGTACGATAGGCATGGTTTAT GAAAAAATACAAGCATGTCTAAACGATTGCATCTTTTTATATCATAGAGAATACAAAGATATAACTAAGTGTCATAAATG CAAGCTTTCTAGATGGAAGCCGATCAAGAACTCTAATGGTGAACATATGGAAGGCATTCCCGCAAAGGTTTTATGGTATA TTTCTCAATTCCGAGGTTTAAAAGTTTATTTCGGAATCCTAACATGCAAAACGTTTGAGATGGCATCATGATGAAAGAGC TAAGGGATGGCAAACTTCGACATCCAACAGATTCATTGGCGTGGCAAAAAGTGAATGAAATGTGGCCCGAAATTGAGAAA GACCCAAGGAACCTCCGACTTGGTCTTTCTGCAGATGGTATCAATCCCCACAGTACTCTTACTTGTTCATATAGTTGTTG GCCCGTACTTCTTACTATTTATAATTTTCTGCCAAAATTATGCGTGAAAAGAAAATCTATAATGTTGTCGATCTTAAAAT CGAGGCTAAACAACCAGGGAATGATATAGATGTGTATTTAGATTGTTTTGATGCGTACAAAAAAGAAGATTTTAAGTTAA GGCCGTATATACTTTTTTGGACAATCAATGATTTTCGTGCTTATGGTAATTTGTCTGGGTGTGTTGTTAAAGGTTACTGC ATGTCCAATGTGCGGTGAGAAGACATGTTCGAAAAGCTTAAAAAATTGTAAGAAAGAATGTTTTATGGGGCATAGAAAAT ATTTGGACCGTGATCATGCATTCCGGAGGCAAAAGAAAGCTTTTAATGGCGAACCAGAGTTTGGAGAAGCTCCAAAACCC TTAACTAATTAGGGAAGAGGTATAAGAAAAGGTGAGTTAATTTTGGTAAAAAGAGTATAGAAAAGGGACAAAAAAGATAG AGATGAAGAAGAAAGAGAGAAAGAGGTTGAGGAGTCAGAGGAGGTCAAGCTTATTAAAAAGTTATGGAAAAAGAAGTTAA TTTTCTTTGAATTAGAATATAAATAACCGTCGTCTAATGTGTACATTAGTGGTGTTTTTACAAAAAATTGTCCTCTAATG TGCCTCATACATGCGTATTAGATGATAGTTAAAAACCGTCGTTGTATGTTGTGGACATTTTACGACTCTGGATATGACGA CGGTTTGTAAAACCGTCGTCATATCTTTGAACGACAATTTTTAATGGTGTTAAATGTGATATTTGTACTAGTGTGTTAAT TATTGTCATTACGATTGTGAATTACGTTCACATTTATGTGTTGATTGGCGACAAATGAATCACTAGCGCCTAGTTGAGCA TGTTCTGTATCCTGTCTATACATGCGCTGCTAATTTGGCTTATGGTTATGCGATTCTTGTTTTTTAACACATGTTGTTAT GTGAACATTTATTGTTTTTAATTAAATTTATAAGGTATGGGAAAATGTCTTACGGATAGAAATTTGTATTGAACCATCAT ATCTATATGTGTAAAGTTTTGACTGTTTTGCGTACTTTTCATTAACAAATATGATTTTATCACTTTAAACCACATTCAGA AAAAGTCCTCTATATATGCATCAGTTTTTTATACAGTCACTGCGTTAGAAAGCTCCCAGTAATTTCTCAACAAAAAAAAA AACCCGGCGTAAAAAACCCCCCAAAAATTTCCAAAAAAAAAAAAAAAAAAAAAAAAAAGCTACCAGTAAAAAAATAAAAT AGAAAAAAAAGCTGTCATTGGATTCTAAATGTAGAAAGAGCTCGAGATTGCTTGAATGGTAGTTTAAAGATGCTAAATGC TTTCCTATCTAAAATCTTCCTGCTCGTTAAATAAAGAGTGAATCTTGCGTTCAATTAATCATGTTATTTGTACGATGTAG AATAAATTAAGAATCTAAAAAAGTCCATCTCTACATAAAGAAATTTGTAGGCATGGTACTAGTTTACACTAATGTTTTAA TATGTAAAAAGTAAAACAGACCGCTTTTAATATAGATCTGACGGTTAAGAAGTAAATAACTATCGATAATTTATTTTTAC AGAAATTATTAGTAAAAATCCCTCATTTTTATTTGTATTTTTATTTTTGTGTGTTTCACTCAATTTTTCCCAGTAATTCT TTCCACTTAAATCGATATCATTTACCAACCAGAGTTCTTTTACTAAGAATGTTTCAATATTCGACCGGCAAAAAAAACAA AAAAAGTTCCAATATTATGCCGATAGTTTCTTTTTCTTTACCAATCATGACAAGTTAAAGGTCAGTACTTGTGCCAAAAA ACTTTTTCTTTTTATTAAAAAAAAGAAAAATCAAATTAATCCCCTTTGAAAAGTAAAAAAGAGAAAGCAAACATGTCTTG CAAGTGGAGCAACGTTGATGCCCAGCTTGGATTATACACAACCCCAATATCGCATGATTTGCGTAGTCAAAATTTAAAAA ATAAAAAATAAATCGACAAATTAGAGAAGGGTATTCAAAGCAAGTTATTCGCTTACGCTTTGCTTATTTTAAGAAACAAA AAAAAAAAATTGAAAATTATTCGTTTAATTAACTAGAAAAAATTATATTACTGCAGAATTATTTACTAGAATAAAGTACC GTCCTCAGAAATGCGAGGCATCGGCGTCATTTGCTGTGAAATAAATGTACGTTTCGTTTGGTGCGTAGGATAGGACAACA TTAGATAGCAAAATTTTAAAGTAATGAATTGAAATGTATGGAAAAGAGTAGGATTAGATTTTAGTTTAATCTAACCCAAT GTTTTTTTTTTTTTTTTTTATGACTAAATGTGATCTTCATTCGCACAAGAAACAGGGCCAAGGGCCTACCACAACAGGCG CAACAGCGCAAAAACAACATAAAAAACTAATGACTTCTTCATTTGTATTCAAACTCAAAAAATGTTTAAATTTAAGTTAC AATTTTATTTAAATTCATGTTCTTTTGTAAAATTTAAGTTTGAACTTGAGTTTAGAATTAGAATCTGAGTTCAAGTTCCC CTTTCAATTTAAGTTTATAAATTTAAACCCAAGTTAATGAATAATATTTTTTTTTAATTTTTAAAAACGTTATAACTTTT TCGTTTTAATTCCCATTAAGATGATTTTTTTCCATGTGTTCACAATAAAAAGACGAATAAAACCTCATCCATATACCCTA TTAATATTCTCTATCACCATTGTGTTTTTATTAAAATATTATCTAAATACAAATTCAAGTTTTAACCCACCCAAATACAA ACTCAAATAGATTCTCAATTCAAATCATAAATCAAAATGTGCACGTCCAAACACAAACTCAAATTATCAACTCAAACCAT ATTCAAATACATCATAACTCAATTCAAAATCTAAGACTCGACAAACCAACTAAACAAAGACTACCAAACTAAGAAAACCA CCAGAAGAACAAACGCAACAAAACCAACTAAACAAATAAAAGACAGCAAACCCGAAGAAAAACTACTGACCCCAGACCAC AGAATTGGACAGAACATCCTGAGGCAAACTCGCTTATCTCTAAAGCACCAGTCCTTTTCGTGACCTTAGAGTTATGACCT TAGCCTGTCCAAAGAGGAAAAGGAAGCTGCTAATTGATGAATCTCAGACAGAGCTGCTCTAATTTTACAACTAGACCCTT AATTTCATAAAAATTTACAAATACGTTCTTGGTGATTAACTGTTTTCCACAATATTGTCTAGTTAAAAGTTATCCCATCC TTCAGCAGGGATAACAACATCCCCTTCTTAGAAGATTTGAGCATGGGGCTGGACAAAGATTTATCCAATCCAGTGCTTTA AATATGTTCTTTAAACCAGTATTAAAATTTAATCTTATCCAACCTTATCTAATCCTTTTCTACGCACCAAACATGCCTGA AATGCATATTCATGTCTAATTATATACGGAATAAGTATCTGAAATAAGTACACCTCATGAATTAAATGAGACGTATATAT AACTCTAGTACTACAGATCTTTTTTTTTTTTTTTCAATAACATGTTACTTACATATGTTTACGTTGTTGTATGATCTCAT GTCTCACGTTGTAATAACGTACAGCTGGTTTTTTTTGTTTTTTTTTTGTTTTTTTTGTTTTAGTCACGCACAGCTGGTTA ATACTCCTGACTTTTCCAAATAAAGAAAAAGCAAAAGGGAATAGACTGGCCAGATAAAATTATGGGCACCTTTTTTTTAT ACATTTTTTAAATATTATTAAAATACCCATTAATAAAATTATTGTTAAGGACAATAATATTTTTTAAAAATACTCATTGC ACATTCCATCATTAAGAAAAAATATATTGCCTTCTAAAATTTACTGTGTCCTACTTTTTCAGAAGAATAACGATGAATTC TAACGTGAAAGAGTCTCCCCATAAAGAGGTACATGGTTAAATTATTTCTTAAAAGTTCTTTTGTTTTAATTTAATTTTGA TGGTTATATCATTAGTTCTAAAAAAAAAAATCATGATTTATGAAAAAAAAATTTAAAGAAATTTTTTTGACTATGACTAT ATATTCTGCACGCTGACATGCGGATTTTACTGTGTGAATTGAGTATGGAAATTTGACTTCACTATGACCGAAGATCATCC TATTTGGTGACAACAGCGTCCCAACTTCTTTGGATTATATTTTCTTTGCGTCTAGTGCTTTGGGAAACTATATGCAGGTC TAGGAACCAGTTCGTTCACCAAGAAAAGCCTTTTGATCTAAACAGCGTCGTCCAAGAGGCTCTCTCCGAAGATCGTATAG GTACCAGGAAGTGCTCCGCTTAATATTTTGAGTCACTTTTTAATTTGGCAACATCATAGAAGAATGACAAACAAACAAAA AAAGAAAGAAGAAAAATGGAAACAATGTTCTTATTATTGGTGGGAGGATTAAAAAAAAAAGACAAAAACACGACTTTTTT TTTTTTCTAAATTCTAAGATGGCGTAACAAATAGAATGTAGAGTTGTTTAAGAATGTGTGTGTAAGAAGTAGTGTAAAAA GTAGAATTGAAAGTGATTTAGTTTTAGGGAATTTTTTAAAATTTTAAGAGCAGTGTAATAAGTAGAATGAGGGTGGTTTA AGAATGTGTGTGAAAAGTAGAAAAATGGTGTCAATAAACACACCTTAAAATTATAAGCATGGAAATGCCAAATTAAGTGA ACAGAAAAAAAAAAAAGAAGCCAAATTAAGCAAAGAAATAAAAGACAAAAAGAAATTACCCTAGCCATTACTTTACCTAT TTTTTTGTGGTGTGCATTACGAGTATTCTTTATTGGCTTCTCTCTGGCAGACATATGATATGCATGGTAAAGCATATTTC ATACAAATTCCATATTATTAATTCATAATTTTCACTATTCATAAATACTGCTAAGTTATTGAAAATATTAATGTCAATGA AGTGATCTCATTCATTAATAACTCAAACGAAAAGATATTTATAAATATGAAATTATAATTAATGTAAGATCAAGATTAAA GTAAAATCAATGCCGACGAGATTCAATGTCTGATAGTTATTTAAAGGTCAATTAAATCTCATTTTTTATTCAGTTTAACG TAGACATACTACACCAGTAAATTCATACATAATCAAGACAAATCACTCAAATGAACTTAATACAGTCTAAACCCAACTTT ATTTATCAACTGCGAACTTCATTTATTTAATCATAAGATATTTTTGTATTTATGACTTCTGTGATTGTCTGTAAAAATAA CATAAATATATAAAATATAATTAAAATGACATTTTTTCAAAGATTCTTATGCACAGAACATATAATGAAATGCCTCAATA ATTTTATTAATATCAGAAAATAAATACAAAAAATACTTTGAAAAGCATATAACCGAACAACTTATTTACGTTTATATGTT GTTGTTCGCATGTCCCACGTTTTAATAGCGTACAGATGGCTCTAATACTCCCGCCTTTTCCAAATAAAGAAAAAGCAAAA AGGAATAGATAAGCACATACAGTGCCAAGTGAAGCAAAGAAATAAAAGACAAAAAGAAATTAAGTACCCTAGCCATTACT TTACTTTTTTCTTTTTCTGAAGTTTTTTTTTTTTTTTTTTTTTTGATTTTTTTTTTTTTTTTTTTTTTTTTGGGTACTTG TGTGTGAATCACGAGTATTCTTTCTTGGCTTCTCATTGGCAGACATATGATATGCATGCCAATGCATATTATAAAGTAGA CTAGTTTGTATATATAAGCTTGCACAAGATCATATTTTCTTCACAAAACCAAATCATCATTTTTTTTTAGATTTGCTACT ACACATTAAAACTATGGATCCTTCAGAGGATACCAAAAACAAAACCGGTCCAGAAGAAGAACTTATCGACAAACTATTCA AAGCTGTGATGAAGAACAAATGGGAAGAGGTCGTGACGATATACAAGAATGACTCTACAGCTCACGAGGCCAAGCTGATA ACCCGGTCGGAAGATACAGCTTTGCACATTGCGGTTTCAAACGGGCGGACTACAAGAGTCGCCGAATTGCTCGAAACAAT CAATGAAAATGTGCTTATGAGGATGAAGAACGCAAAAGGAAACACGCCACTGCATTTGGCTGCAAGTCTCGGGAACCTGA AAATATGCGCGAAAATGGTGTCGAAAAATCGCGAAGTTATGGCCAATCTTCTTGCTGTTCGCAACGAGGAGGGGGAGACG CCAATCTTCTTGGCAGCTTGTCATGGCCATGATGATGTTTTCTTTTACCTGACCCAGAACATTCTTCACGTAGAAATAAA GGAAGAATATTTACGTAGAAATAATGGGGACACCATTCTTCACGTTACCATCTCTGGTGAATATTTCAGTAAGTACTCGG GCATGCCATTTTTTTCATGAATTTGTTTCTAGCTTGCCTTGGTTGAATTAATTCTTCAAGCTTTCACTTTTTTTTTTTTT TTGAAGAGTTTCATGCTTAATAAGTTTTAGTTACATAAGGACAAATGGAAGAGGAGATTTTCTGACTATTTTTGGCTTCA TACAATTACCTTTAGTAATTTTTTAAGAGAGTAGATACTTTATCTATTTGTTTTTGCGCAATTTTCCTCACATAGTTTGA TGCTTTTTTAAGGCTTCTTTTTTTTTTCTTTTTTTTCTTTTTTTGCCTTTCGGAATTTGTTTGCTTTAGTG