>DTC_11_1_Mno length=10779;Class=DNA transposons;Order=TIR;superfamily=CMC; CACTAAGGAAGGAGTCTCAATACATAATACATATGAACGGAGGCTACAACTCAAGAGTAAGAAATAAAAAGCATGAGAAG TATGAGGAAGAAAAACCTTTCTCACACACCACACACCATACACAGGACACACACATACACACACACACACTTTATATATA TATATATATATATATATTTATATGTATACACACGCACAACACATGTGTCTCAAAAGTGAGACCTCCCAGCCTTTTGGCTT TACTTGTGTGGCTTTGTCCCTGAGATCTTTTGTTGAGTACTAGGTGCCTTGTTTGGTGTGGCTTGAGTTGGGTGATGGGT GATCTTCTGTTGAGCCGCGTGTTGAGTGGTCTTCTGCTGAGTAATAGTGTGTGTGTCTTCCACCACAACAGCTTTTGCTT TGCCTTGAGTCGTACTTGTGTGATGGGTGGTCTTTTGTTGAGTCTCTGTACTTTTCCCCAGGTCGGTTACCATTTTTGTG TTTCCTTGCTTACTTGTGTGATGAGTCATCTTTTCTTGAGTCTGTGTATGTCTACTTTTCTCCCCTGTAACGCCTTGAGC ACTTTTGTGATGACTGCTCTGTTGTGTCTTTGTCATGGCTTTGTTTGTTGGGAGGATTAATATTTGCTTCTAGTTGCTAT CAAGTTATTATCTGAATTTTCAGAGTTCAGACCAGGCAAACAACTATATCTATATTATTTATAAATCTACTTTTCGGTAC TTGGGACTTTGATTGAGAAGTACAGGTGCCCATGTTTGGGCTCCTCATTTAAACTCCAGCTCTGTAAAATTCTTAAGCCA ACATTTGGACTCCTTTGTTACAACCCAGCTGTCCACTACACATATCAATCGGGCCTTATCTATCTTCAATTGGGAAATTT TTATCATAGGAACCTTTCATTTCTCGTACCGGCAGATATTGTTGCTTAACTGTTGGATTAAAATTTCATTGATATTGATG CATCAGTTGGAGCTATTCTATATCGCTGCGTTGTAAAGTTAAAATAAATTGTCGAAAACAATAATCCCAACGATTCAAAC ACCAATTCCTACCGGTAGTGACAGCCTTTTTTCTTCTCCCCCTCTCTCTCAATTCCTCAGTAATATCTTCTCGTACTTTT TAAGCCTTTTTTTTCTTCACTCGATAATATCTTCTGATACAGATAAGGTTGGTTTGTTTGTTTTGTTGTGTATTTTGTTT TTTGTTTTTCTTGAAGCACAAGAAGTACCGTAGGTAGGCACGACTCCAATCTAGGATGGTCGTTTCGTCAGGAACAATGT CGTCAATTGGTTGTGTCAAGATTTATATATTTGCTGAAAGGAGACTTTGACTTGTAGAATATTAATTTGACCTCATTATC CAACATCTCAAGTCTTGTTTGGTCATATTATTATCGATTTGAAATATTAAATTATTGGCTTCATGCACAAGATGTGAATC CAAATACCCAACCGGAAGTCCATAATTTCACGTCATGAAACGATGATAACTATACCTTAAATTTCTTGCGGAAAACAAAT TAAAATGAACTAACTTTTTACATCACTAATCTTTTATTATCAAGTTATTTCTTTTTTTTTTTTTTTCTAGCAAAAATGTT GTTTCTGTTATATATCATATAACAATGCATCCGAGAGACTTCATGCATTACAATCTGAGAGCTTATAGATCCTTCAAGAA TTAAATAAGCAATATACCCGTAAACAAGCTACAACATATTAACACAATTTCCCTACTTTTTTGGGCATTTGTTAAACAAC AAATTATTCCATGATCTCCATCAGCTTTAATTATTTTTCCAATTGGGTAATGCCAAGCATCAAAACAAGCCAAACATATC CCAACCTTTATTAAATGAAATGAAAAATAAATTTACAGTATTCACAATAAAAATGTTAACAAGCCAAAGAGTGTGAAAGA AAACAGACTATACACAACCACGTGTACAAAATAATAACTGAAAACAACTGAACAACAGGGAATCTAACTGTACATTTGTA ATATAAGTGTGATTAGAGTGGACATCCATAGGTTTGAGCACATAACCCTCAACTTGGATGATTCCATGAGAAATATGCCT CGTTAAAATATCTTCCTAGACAAAGTTCTAGTAAGGAAAAAAGAGTGCATATTTTGGAGAACCACTTGGAGAAATCCATA ACGCAACCAGGCAGAGTCACGAGCACTAAGATTGGAGCATAAATATCTGAAGCAGAATGCCACCAGATTCAACCTTGATT AAGATGAAATCACAAGTTAATAGAAAAAGAATTGAAAAGAGAACAGAGGAAATCAAGTAAACAAGTTAATAGAAAACAGG GAAAAAAACAGACGAAATCACATGCGTAAAAGTACTACGATTACTCCAATGTGTTCTGCATCTAGCACAGAGTCGAATTG GTACCTGGTGCAGCGATATTTGAGTTTAAAAAAAAAATGTTGAAGATGATGCCAATTCCAAGCTGATAAGATTGAAAAAC AGACAATATATAAGAACACAAATTAAGAAAAAACTAGTGAGAACATGATAATGATAAATGTATTGTTACCTAATTGCTTT GTATGTACCTGAATGAGAGTACTGGAAATGATCAAAATCACTTCCCAAAGTGTTTATTAGGAATGTGAGCAATCTTATCC CAATCTGCACCCGTTTCACGTTGGCATCGTTGCAGCAGCGTGGAACAATCTTCAATCTCTAGTGTTTTCAAATTGGTAAG ATTGCTTATTTCTTCGGGAAGCGACTTCATGTTAGGACATACCCAAATGGCAAGCTTTTCAAGCGACTTGAGATCTCCGA TCCACTTCGGAATGGAACTAATGCTGCGGTGACAATCCTGTAGATTGGTCCTTGAGCAGTTCTTCGAGCTCTGGAATGAA ATCCAATTTCAGAACACGTAAGGCGTCCCGCGTGTAGAACTTAACAACCTCGCCTTTGTTAAAATCTTTAATGTTAACAA GACTCAAGTTCATCAATGGAAGAGCGCCTCTTCTTCTCTTCATCGTCTCTTGAAAAAGGACCCAACTAGTTGTGTCCAGC ACGAGCTCATCTTTTAGAGTTGGAAAAAGCGGCATGAAACGCAGTTCGGGACAGTCCTGGATGGATAACTTAGAAAGGCG AGGGAATGAAGGAAAATCGTCATCATCATAACTGAAGGCTCCACCTCTCCACCATCCTTTCAGCCGAGGCAATTCTTCGA GTTGAAGTTCCGAAAAAAATGGTTCGCATGCAGGGTTTTCCTCTGAATTGACGTACTCCAGATTTCTCATCTCATGGAGT ACCAAAACTTTAAGAGAAGGAAACTGATCCAATGCCGGTAGGTATTCGCACCTCGAACATTTTTGCAGCGTAAGTTTGAC CAGATTCCTTTGTGGGTTAAGCCAAGATGATAACTTCCAACCCCCATAACCATGTAATGTCAATTCTTTTAGATCCAAGT GTGGCTCCAGATCTTCCAATTGACTTTCATGATCGGACGTATTATGGTTTTCTGATTGATCAATATCCCAATCTAGTGAT AAGAATTGAAGATCTTGTTTTGCTCCCAAAACTGCAGCCTTAGCATCTTTCCCTGGCGTCAAATTCTTAATTGGAAGCCC TCCCCTCAGGTTGTTTAGATTTTCTAATTCGTTTAGCCCGCCGCTCTTCTTGTATGCAGAATCAGAGTCCTATCTTAAAT GCTTCAATTTTTCAGTGTCATAAGGCACTACCTTAATCCCCAAATCATGCAGATCCAATGCGCGTAAACGTCGAAATGTT GAAATGATTGCATCACTAACTAATCCTGGTCTCCAATGAAGAGATCCCTGCCTCAATTGAGGTGCAGCAATATGCAAAAT CTTTTCTGGATTAATCGTCCCTTGTTCATATCTCGACAATGATTGACAAGGCAAAAGAATTGACCGAATCATGTCTGGAT CATCCTTCATCTTTTCTGGAATTTGTCGTGGAGAATGCAAATGAAAATCAAACTACACATGATGAATTGTGGGATAATAA ATATTATAATATATGATCAGGTTGATCAACTTCTTCGAGGAAGCCTCCGTTAACTAGTTCCATAAAATAATTGCGACCTA CATCCTCTAAACATTGACTTTGACAGTGATAAAGAGCCTGATGAGACAGATACCGTAAGTAGTGATGAAGATCCTAATCA AACTGAAGAATTATTTCACGTCCTATCTGACATTGCTGGACCAAGTACAGAGGTCGGTGAAGATGTTGCTTCTGGAACTG ATGAGCAATGCGAAGACTTGTTCTCAGACCTAGAGATGAAATTATATCCGGGTTGCTCGAGGTACTCTTCTTTGAATTTT CATGTTAAGACGATGCATTTGAAAGTGTTGCACAAGATGACAATTAGAGCATTCGATGATTGGGTCAAATTGATCAAAGA CGCTCTTNNCGCTCTTCCAAACGGAAATAATCTTGTGAAGTCTCATTATGAAGCGAAGTCGAAGCTTCAAAATTGGGGTT GGGGTATGAGTCAATACACTGTTGCAAGAATGACTGCTATATTTTGGAGGGACACTGCCAATTTGGATTTTTTTCCAGTG TGCAATGAGAGTCGTTGGGTTGACCAAAAAACAAAGGGGAAGAAGGTACCACACAAAGTTATGCGATACTTCCCTTTAAA GGATCAGTTGAAGCGACTTTATAACAGCTAAACTGATGACATGGCATGACAAAAATAAATCGAGACTTGGAGTTATGCGG CATCCGGTCGACTAGGCTGAATGGAAGGAATTCGACGAAAAGTTCCCTGACTTTGCAAAGGAGCCAGGAAATGTCCGTTT GGGATTAGCTGCAGATGGTTTTAACTCATTCGGTAACATGAGTGTCTCGTATAGCATGTGGCCTGTTGTCATGACGGCGT ATAACTTACCCCTTGGCTATGCATAAAGGAGTCGTACTTGATGTTGACTCTGCTGATTCGTAGTTCAACTGCACTTGGTA AGGACATGGATGTGTTCTTGAGGCCATTGGTAGATGACCTAAAAGAACTCTAGACTGAAGGGGTTTCAGTTCACGATGCG TATACAAAGAAAACATTTAATATGCGTGCCGTACTACTTTAGAACGTGAATGATTTTCATGCTCATAGTAGTTTATCCGG TTGGAGTGGGCAAGGGTACGAAGCATGTCCAAAGTGTTACAAAGAGACACCGTTGAAGCGGCTTAGGAGCAAAATTGGGT GTGTTGGTTATCATCGTTAGTTACCGCCTGACGACAAGATATGAAGAAGTCAACTTATGTTCAGTTTGTTAGTTGAACTT GTAATATTATTACTTTTGACTTATGTTTAGTATTCGCTTTTTATTAATTTTTATCGTATTTGACTATTTGTTAATTTAAT TTATTATATTAAATTTTATTATTACAAAACAATTTTTATTAGTCATTTCAGATCAAATCTAATTATTAAAATTAACAAAT AAACTACAATATTAAAAAAAATAAAAAATCAATTATTTAATTATTTAAAATATAATTTCTAAACTTTAAAAGTAAAACTT TTTCAAAAAAATTGGAAAATTAAAAATTTATAGCGATGATAATTTTAAAATAGCCGTCGCTATGACGACACATTCAACGA CGACAATTTCAACTATTGTCGTCGCTACATATTATAAACGATTATCCTGACGACTTTTTGACAACTTTTCAGCGACTATG GTACATTTTTACAACGACTACTCTGTCGTTGTTGAATGAGGCGTTTTAGCGACGACAATACTGTCGTCGCTAAAGGTCGC TTTAGCGATGGGTCGGTAGCGATGCCTATGTGGCGACGAAATGTCGTCACAGAAAAATTTTTAGCGATGACATTTGTCGT CGTTGAAAACTAATTTTCCTGTAGTGTAACCATAAGAGAAAATTAGTGAACTCACCTTTTAAATGCATTATTTTAAGATT TTTACCTTTTATTTTTTATTAATATTCTTTTAACTAATGTAGTTCTTTAACTAAAGGGTATTAAACAAGTATGAGGGATG AAAATCTAATATAGCGATGATAATTTTAAAATAGCCGTCGCTATGACGACACATTCAACGACGACAATTTCAACTATTGT CGTCGCTACATATTATAAACGATTATCCTGACGACTTTTTGACAACTTTTCAGCGACTATGGTACATTTTTACAACGACT ACTCTGTCGTTGTTGAATGAGGCGTTTTAGTGATGACAATACTGTCGTCGCTAAAGGTCGCTTTAGCGATGGGTCGGTAG CGATGCCTATGTGGCGACGAAATGTCGTCACTGAAAAATTTTTAGCGATGACATTTGTCGTCGTTGAAAACTAATTTTCC TGTAGTGTAACCATAAGAGAAAATTGGTGAACTCACCTTTTAAATGCATTGTTTTAAGATTTTTACCTTTTATTTTTTAT TAATATTCTTTTAACTAATGTAGTTCTTTAACTAAAGGGTATTAAACAAGTATGAGGGATGAAAATCTAAAACCCATACA TTCTAAGGGATATTTGTCTCATTTTTCTTAATCATAAGCGAAATTAACTACATGGTAGTATCCGTTGGCCAATTCCTCAA CCATACATGCCTTCTGTTGCGAAGCCCATCCATGAGTTGCAAGCTTTTTACATACATTATGAATTAACTGGTGAGCTAAA GTGCAACGTGTATAAAATATTTCTCACAAAAATATTTTTCAAACATATCATCATAAAAAAAATGCATGACCATTTATGCT TCATTATGTACAATAACTCAACTCCTTATTTTCCTTTTCCTTGAATAGAAAATGTTAAATTTTATTCCTGATAAAAGATA CGTAAACTTAGTACTGAAAAAAAAGTACATCCAAAAGCAAGATCAAGGTAATCATCTGGGATTGATCAATTAAGTTGCTA ATTGATTTCATTGCTCTAGTCATTTGGTTTGATATATATGTACTAATGTTTAACTTTGGTTGCTTTAAAGTATTAAAAAT TTTAAATTATGGGCAATGAGAATCGAATTGCTTTGCATGAATTACTTTGTTCACTTTTTCAAAGTAGACGAATAAATTAT ATGCGTCTTTTCCTTTTTGACAAGTTGTTGAACGAGAAACTGGTTTACCTCTTGCAACAACTAACTAGATCCTTAGTAAT AAGAATTGTTTTTTCAGCTTGTAGAAAAATTCCTTTACAAAAAGAAAGATTCTGAAATTTGGAAAAGAAGAAATTGTGTA GATTGTCGTATCAAAATGCAGAAAGATGTAATTACCCGTCGTAAATAAATCATCAACTTGTGAACTGTTATTTAGTTCAA ATAATTCTAAAATCTGCAATTTACTTAATTTAATTTCAAAAACATGCTATTTATCATAATTTCCCAAAAAAGAAGTGTAA ATATCCTCTTTAAACATTCACAAAATTACTCTCTCGTCTTTTTTTTTTTTTTTTTTTCCAAACGCTTTTCCCCTCCTCAA ATACCCCTTTTAAAAATCAAAAAATTTCCCCTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCCTAACCGTTTCTCCCTCTC TCTCTTTGTTTCTCTACAATTTCTCAGTAAATTTCTTCTCTTAATAATTAGCTTTTTTTTTCCTCACTCCGTAATATCTT CTGATCTTAATAACTACTCTTTTTTTTTTTTTCTCTTCCTGTATACAAAACCTGAAGTACTAAAGTACCATAGACACGAT CCCAAACTACTCGAACTAGCTAGTATAGTTAAGAAATTAGGAAGTATGTCGCCATATGACAAAGCGAGACTCAATTTATC AGCATCTTAAATTGAATATTGTTCAAAATATTATTTGGTATGAGGATTCGTGTCATGGTTCGAATTATAATTCGTGACTC GCTACAGTATTTTATCTCACAAAAAACACACATAAACTGAGATTGATTCTGAATCATGATTCTAAATCTATGAACCAAAC GTCTATTCGTATATATACAAGTAATTACATCCTTCCGTTCCGAAATTGTTTCTAATGTGTATCTAAGGTTATTTATTTTT AGGTGAAGATGAGAATGAAAGCAGAAATTAAAGATCTTTCAGTCAAAATGGAAGCCACAAAGAGGAACCTTGCTATGTAA ATTGGCCGATTAACAAATTTTTCTGTCGATTAAGTTACATCCTCACGTTCCGAAATATATTGTTTTTAACCTAATTTAAG GTTCTGATCCACGGTATAGTTATTTTATCTTTAGGCGTGGCGTTTTGTTTGTTTTTTTTTTTTTTTTTGAAATATTTGTT TTTTCTGTTCATTAGCTCCTTTTTTTAATTTGTTATTCACAAATAAAAAGTTAAAAATATGAATAAAAAACCTTTTCATA AACTCTTTTTTTATAAACACTTAGAAAGTGATTTGTCTCAAAAAAAGCTTATAAAAATTAAAAAGTACTTTCATGTTATC CATCTAAAAAGCCTTGTGTACACACCGAGAGAATGCTTTCGGTTTTTTTTTTTTTTTTTCTTTTTTCCTTTAATTTTGAA AAGCATTCATTTCCAAGTGAAAAAACAATAAAAGGGTTGTAAAAAGAGAGGCACCGAGCCTAATTAACAAAAGTGAAACC TGTAAAATCCAAAGCAAATAAAGGAAATAAATCAAAATAATGCAAACAACATTCTCAGATTGACAATCAGATAGGGGCCA ATAAAGTCCATTGACTCAACTTGTAAGCGAAAATATATTGTCTTTTACATGTGATGTACACATGTTTTATGGTCAATTAT ATACATTCATCGCCAATTTTATCATCATGGACCAAAAAAAAATAAAAAAAGAGAGTTTAAGAGTGATTTGCTAAAAAAAA TAAATAAATAAAAGATCAAAATATCACAATGCTCATAGTTTGAGAACTAAGGCCTCGTTCACTTCGTTAATTCGAATTTA GAATTCAAATTTTTCTACAGTAAAAAACTCTCATAAACAACCACATCTAACTTTTTTATTACAATAAAAAATTATCACAT AAAATCAAATCTCAACTCGAATTCTAAACTCAAATAGAGAAATCTCAACTCGAAATAAACCTAAATTTTAAAAAATGGAA TCACTTGGGTTTTTGGGTCAGCATATTTTGGAGAATAGTCAAATGGCCTATATACGTAGGGGAGGATAAAAATAAACGGC CAGTTTTCTAGGGTGAAAAAAAATAGTCGATGAATTTAATCTCAAATTTTCAAAAATTCCCGTTTTACCCCATGCCTTCT CTCTCTCTCTTAGAAATTATCCGGTCGTCGGCGTAGAGGTCGATTTGTCCTCTCCCTCATGAGCTTGACGAAGAAACAAG CCTTATCGTCGCAGCAAAGTGTCTCTCTCAGAGAAGTTATCATTGCAAGCGTGACAGATCTCGCCATTAAGACATTTTTA TTTCTCATTTCTTTGTGGGTATATATATCTTTTCATATTGTTAGGAAAATACCATAATTTTATACTAGTGAAGCTAAATA AAATAACAGAAAAAATAAAACAAGCAAGAACAAGCAATGCTTTTAGTGGTTCACCTCGACGAAGGAATCACGTCGAATCT CAGCCGTTGTAGAAAATTACACACCTCTTAGAACCACGATTTAGGAAAATACCTTACTTTGTAAAGAGCTCAAATTATAA CGGTGAAAATCCCCAAGTACCCTTAATTAAAAAAAAAATAAAAAAAATAAAAAAAATAAAAAACCTTGAAAAAGGCAATA ACAAACTAGAGTAAGTAACAAAGGCTACAACTCATGAAGGAGTCTAAATACATAATACATAAGACGAAAGGCTACAACTG ATCAAGAGTGAGAACTAAGAAATAAACCACAAGAAATACGAGGGAGAAATAATACACACTTGTACACTGTGTCTCAATAG TAAGATCTCCCACCCTTTTGGGGCTCTTTGCTTAGGATCATTGGCATGAATAAGTTTTCCACAAAAACCATGTTATTTGG TTGGCCTTGATGAGCACCTGGGTGTTGAGCGATCTTCTTGCCTTTAGTCTGTGTGTTTGCTTTGCCTTGACTACTTTTGT TATGAGCGATCTTCTTCTGTTTAGTCCCTGACGACGTGATTGCTTTGCCTTTGGACGTACTCCCGCCATTAACGATCTTC TTGTGTTTAGTTTGTCTGTTTTCCACAACCGTTTTGGTGCTGCCGTGAATACATGTGTAGTGAGTGATCTTTTGTTGAGT CGTTGTTTTCTCCTCAACAACTGTTTTTCCCTTGCCTTGAGTGCCTTTTTTTTTTTTTGTAATTAGCCTTGCCTTGAGCA CACATCCTGTGAAGAACGATCATTTGTTGAGTCTGATGATCCGTCTTCTTTTTTGCCATGGCTCTGTTGATTGAGGAAGG AGAAGAAGACTGGCTTGTTGACCAAAAACACCTCACTCTTCAGTCTTCACTTTATCTTGCTTTCTTTTAATTCCTCGCCT TGTGGTATAATAAAAAACAAAATGCTGAAGAGGAGGTCTCTATTCATAGCCTTGAAAGGCTGCCGACACGCACAGTTTGC AAAGACTTAATTGTGAAGTTTACATTAAAAAAAAAATTGAAAGCATAATATTTTACTCTACCAGGAAGAAAATTAACGCC GATTTGAGTTTTTAATTTGAATTAAGATGTAATTTTATATGAGAGTTTTTTACTGTAATAAAAAAAATTAAATTTAATTA TTTATGAAAAATTTTTACTGTAACAAAACTCAAATTCTAAATTTAAATCAGTAAAATAAACGAAGCATCAATTTTAACCG CTCGGTTAGCTTTTTGACAGTAAGATATGTTCATGCCTTTATGAAAAGCTTATATAGTG