>DTA_9_1_Mno length=2453;Class=DNA transposons;Order=TIR;superfamily=hAT; TTTAGGGAGAAAAAGATGAAATGTGGTTATAAAAAAATCCTAAACATAGCATTCCATCAGATACCTTGAAATTTCAAGAA AGCAATGGTACACTTAAACGCACTAAACTTTAATGTAAAACTAGCCTTCAGTGCATAGGAATGATGAGATGAAGTAAATA AATTCAGGATTTTGGATATAATATTCAGTTTAAAGTCTCAAAATTTAAACAGAGCTAAATAAATTTGTCTTTGTATGACA TGATTGAGGCTTTACTGGTTGGTCTACCATTCCAATTATGTTCCTCTAGTTGGCCATCAGTTCTAATTATGTTCCAATTA TGTTCTTGGTCTAGAAACGTTTACAAGAGTGGCTTACACACACACATATTCAGTAGAAGGTAGATTATGACCATTAATGT TGCTTTGTGCAGACTATGACCATTAATGTTGTTTTGTGCAGATTAATTTAACACAATGAGTCCATTGAGTATCAAAGTGT GGATGTTGAGGTTGAAGAGATTGATGGGTCGAGTTTTCATACCGAAACTCAAGGCGCTGATCTCCAGAAAAGAAAAAGGA AGCTGACCTCAAAAGTTTGGAGTCACTTTGTTCATCTTCCTTTGGGTCCGGACAAGAAATTGAAGGCCAAGTGCAAACAT TGTAGCTCTGTGTACCTCGCAGACAGTAAGTACGGAACTGGTAATCTGAAACGCCATCTTGTGAATTGTCTGAAAACCTC CTACCGTGATATAGGACAGATGCTCATTGCCCAAGAAGCTGGTGCAATGACACTTGGTGGAGGTAAGTATGATCCTGAAA AATTTTGTGAGTTGGTTGTAGCAGCTATAATCATGCATGATCTACCTTTTAGTTTTGTTGAATATGCAGGAATAAGGTCT GTATTTCAGTACTTGCACCCTCAAATTCAATTGGTCTCTAGAAATACTGCAAAGGCTGACGCTTTAAAGTTTTACAAGAG GGAAAATCTTCGAATAAAATTGATGTTAGAGACTATCCCAGGTAGAATTAGCTTTGCTTCTGATGCATGGACTTCTTTGA CTAGTGATGGATATGTTTGTCTCACTGCGCATTTCATAGATAAGAATTGGAACTTGCAGAAAAGAATGTTAAACTTTAGT TTTATGCCACCCCCACATAGTGGCGTTGCTTTGTCTGAAAAACTTTATGCCTTTTTGAGTGAATGGGGAATTGAAAACAA GGTGTTTAGTATGACATTGGATAATGCTTCTGCGAATGGTGTTTCGGTTGACATGTTAAGNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAGTTTTTAGATTGTGTGAAGTTAGTTGCAATTGGTGATAAGAAAGGG TTGTGTCAAGATGTACCAACTAGGTGGAACTCGACATATCTTATGCTTGAAAGTGCTCTTTACTATCGCCGTGTATTTCA ACATTTAGAGTTGAGTGATTTAAACTACAAGCATTGTCCTTCTAGTGCCGAGTGGGACAAAGTTGAAAAGATTAAAACTT TTTTGAAGTTGTTCTATGATGCAACTCTTAAATTTTCTGGAACAAAGTATCCCACTACCAACTTGTACTTCCCTTCCATT TGGCATTGTTGCTTCATGTTGAAACAATATTTAGAAGGTGATTATGAGTACTTAAAGTATATGGCAACAGCAATGTGGGG CAAGTTTTAAAAGTATTGGTCTCAATTCCATCTTACCTTGGCTATAGCATGTGTTCTAGATCCCCGTTTTAAGCTTAGGC TTGTTGAGTTTAGTTACAAAAAGCTTTATGGAGATGATTGTGTTGAATGCATATCAATGAGGAGCACGTTGAAAAAAAGA AGGATTCAACTAGCCAAAAGACCAATGCTTTTGAAACTTGTATGATGGAAAAAGAAGGAAATGATGATGTGGCTATTATA TTCAAAGTAATTTATCTATTTATTAGTAATGCGGATGTTCTCTGCTTATGTCTGATTGTGTATTCTTATACTATCTTCTT CTCATTTTGTAGGAATTTGATGAGATATTTTTAGTTGAGTCTACTACTGCATCACAGAAATCAGAGCTTGACCTTTATTT GGATGAGCCAAGATTGGCTAGGACCGCGGATCTTGATATCCTTTCCTTTTGGAAATCAAACCAATTTCGATATTCAGTAC TAGCTTCTATGGCTTATGATATATTGGCTGTCCCTGTTTCTACAGTTGCTTCTGAAGCTATATTTAGTGTTGGTGGTAGA GTTCTTGATTCATTTCACAGCTCACTTAAACCAAAGATAGTTGAAGCACTTATTTGTACCAGAAATTGGTTATATGGAGA CAAAGGTAGTTTCAAACTTACTTAAATTATGTATATTTTCTATATTGATTTTGAACTAACTTGTATCTATATATATTTGT TTTTGTGTAGATTTCAATGAAGAGGTAGAGGATCTTACACAAGATATCTTCAA