>DTA_8_1_Mno length=2570;Class=DNA transposons;Order=TIR;superfamily=hAT; TCAGTGACTGACTACCTTCCTTGGATATTGTTTATGTTGCCAAAGCAGGAATTGACCTGTCAAGACAAAGATGGCAGCTT CTGTTGAAGAGCAGATGGTCAGCACTCCTGTTCAAGACCATATGGTTACAACCCCTTCGGAAGACCATATGGTGACCACC CGTGTTGAAGAACATATAGGTCAAGACCATATTGTCACCAACCCTGGTGAAGACCATATGGGTCAAGCCCATATTGTCAC ATCCCTCGGTCAAGACCATATTGTCACCTCCCTCGGTCAAGACCATATTGTCACCACCCTCGGTCCAGACCATATTGTCA CCACCCCTGTTGAAGATAAGATTATTGCTACCCCTGGTGAAGAAAAGACAGCTATCCCTGATGAGGAAAAGATGCTAACT CCTTATGAAGACAAGATGTTAACTCCTTATGAAGAGAAGACACCAAGCTTGTATGAAAATAGCGAGGTGCCTAATCCGGA AACACAGCCTAACAAGCGGAGGAAGAAGAAGTCCATAGTCTGGGAGCACTTCACCATTGAAACTGTGAGTGCTGGATGTA GGAGGGCGTGCTGTAAGCAATGCAAGCAAAGTTTTGCTTATAGCACAGGCTCAAAAGTGGCAGGTACAAGTCATCTGAAA CGCCATATTGCAAAGGGAACATGCCCAGCATTGCTCCGTAACCAGGACAAGAATCAGCTGAGCCCATATACACCTAATTC AAGGTTAGGTAACAGCACTTCTGATCCACCAAAACGGCGTTACAGAACCAATAGCACGCCCCAGGTTTTGTTTGATGCAG ACCGTATCCGCCACGAGATTGCTAGGATGATTATTATGCATGATTTCCCGCTTCACATGGTTGATCACCAGGGCTTTTTA ACTTTTGTCCAGCATCTGCAGCCTTATTTCCAGATGGTGAGCTTCAACACTGTCCAAGGGGATTGTGTTGCAACATACTT AATGGAAAAGCAACATCTTATCAAGTTTATTGAGGGTATACCTGGACGAGTTTGCCTTGCTCTGGACATGTGGACTTCAA GTCGAAGTGTGGGTTATGTTTTCATTACTGGTCACTTCATTGATAGTGATTGGAAGTTGCAAAGACGGCTTCTTAATGTT GTGATGGAACCATATCCCGACTCTGATACTGCGTTTAGCCATGCTGTTGCCGTTTGTCTTCATGATTGGAGTTTGGAGAA CAAATTGTTTTCAATCACTTATAATCAGTCGCTCAGTGAAGCCGCAGTTGAAAATATGAGGCCTCTACTCTCCATCAAGA ACCCACTTATCCTCAATGGTCAGTTGTTGGTTGGGAATTGTATCGCTCGTACCTTCAGCAGCATTGCGAAAGATGTTTTG GATGAAGGGAAAGAAAAGGTCCGAAAGGTCCGTGAAAGTGTAAAGTATGTGAAGACTTCAGATTCTCATGAGGAAAAGTT CCTCGAGCTCAAGGAACAGCTTCAAGTCCCAAGTGAACGGAGCCTGTCTCTGGATGACCAAACTCAATGGAACACTACGT ATCAGATGCTGTTGGCTGCTTCTGAGTTAAAAGAGGTATTTTCTTGCTTGGATACGTCCGACCCAGATTACAGGGGAGCT CCATCCTTGGAGGATTGGAAGCAGATTGAGATAATTTGCACATACTTGAAACTTCTCTTTGATGCAGCCAACATCCTTAC CACCACAACTAACCCAACGCCAATTACCTTCTTCCATGAAGTGTGGAAGATTCAGTCAGAGCTGGCTCGTGCAGTTACAA GTGAAGATCCTTTCATCAGTTCCTTAACTAAAAGAATGCAAGAAAAAATTGACAAGTACTGGAAGGATTGTAGCCTCGCA TTGGCAACTGCAGTAGTCATGGATCCCCGGTTCAAAATGAAGCTTGTTGAATTTAGTTTCAACAAAATCTATGGTGAAGA AGCACCTACATACATCAAGATTGTTGATGATGGAATTCACGAGCTTTTCCATGAATACGTCGCGCTGCCTCTGCCACTGA CGCCTACTTATGCGGAAGAAGGTAATTCACGCAATGTTAAAACGGAGGAATCACAAGGAGGAACTCTTCTGTCCGACAAT GGGCTAACGGATTTTGACGTCTACATCATGGAGACCACTAGCCAACAGATGAAATCAGAGCTGGACCAGTATTTGGATGA ATCTTTGTTGCCTCGCGTCCAAGATTTCGATGTGTTGGGTTGGTGGAAACTGAACAAGTTGAAGTACCCAACTCTTTCGA AAATGGCTCGTGACATTTTGTCAATCCCAGTATCCACTGTTCCTCCTGACTCGATATTTGACACCACTGCGAAAGAGATG GATAAGTATCGATGCTCTTTACGACCAGAGACAGTAGAAGCCCTTATATGTGCCAAAGATTGGATGCAGTACGGGCTACA AGACGTCTCAAATGCACTTGTGAGAATGGAATATTGATTATGATTAGTTTCTGTCATCCTTCATGTATGATGGTAGGTTG CCTGGCCAGAAGTAAAATGTATGTTGGTAGGTGCTGTATTATTTATTAGGCATTAGTTTGTCATTCACCATTAGGTTGGC ATTTGTATCA