>DTA_7_1_Mno length=2487;Class=DNA transposons;Order=TIR;superfamily=hAT; CGCCAGCTTGTGACCGTTGGGCCCGTCGACTGCCAAACCGTCACAAGTTGAGAAATGTACCAAAAATTCATCTATAAATA CCCCTAAATCCCACCTTAAATCTCACACAATAATTTACTATCAACTTCTCATCTCACTCTCATTCTATTTCTCATCTTGT CTCTTTGATATTGATTCTAAGCTTTTCTCTCTCGATTACTCATTTTCTTGCTCTTTCATTTACAAAATTAAATCAATTTT CAGAAATTTTGAAATAAAAAGGCATTATACTTATCAATTTTGTTACATAACATTGTATTACTCAAGTTTATTTATATTTT TTTATTATTTATAAATGAACGAATTAAATTAGTTTATGTTTTTTTTTCTTCAAAAAATGGCCGCATTAAATTTCCTTGAT TTCACTGCTCTACATGAGCTTGGTGATGAGTCATTTTACGAGGATGAAATTTTGGCCCACAACACCATCCCCACTGAACC GAAAATTACTCTGGTTGATAATGCTTCAGTGCACAACGAGGAAGTTGGGGAACGTAGCAGGGGAAAAAGACCGCGAACTT CTCCCGCATGATAACATTTCACAGGGATCCCCGACCAAATCGAAAAACAGGTAAAATGGAAATTTGTGCGGTATGTAAAT ATTGTAAAAAATACTTTTTCTAATAAAAAAATGTGGGGGTACTGGTCATCTGGATAAACATTGGAAAGCATGTCTACCGT TGCACTAAGGTGGGAGTGTGGACTCCTGCCAACAAACACTATCACTCACATCACAAGGGTTGCATAATTTTACATATGAA GCACAACGTGCTCGTGAGGCACTAGCTAAATTTTTAGCTAGTGCCAAATTACCTCCTTCTTTTGCAGATGATGCAACGTT TGAAGAATTTATACATACGACCTTTTGTCTGCAATTTAAATAGGTAAGTAGAAATACAGCTTGTTTTGATTGCATGAAAG TGCTTTATGCAATGAGAGAATCTCTAGTTAATAATCTTTTAATGCTACTATATCTTGTACTTCTGATCTATAGGAGGGGT GCAATAAAACTAGATATTTATACATCACGGTGCATTATGTTGACGATGAATGAGTTTTACAAAGAGAATAATAGATTTTC GTTTATGTCCATTTCCTCATAATGCAAATGTTATTTTTGGACAATAATGAAATTTTTTTGGTTTTATGGGATAGAAGATA AAGTTTTAACTATCACTTTTGATAATACGTCAGCTAACACGGCTACAATTAACATGTTTAAACGTAGTTTGAAATCAGCG TTTGGTGGGTGTCACATAATAAATTTAGTAATTGAAGCAATAATTAAATATATTTCTCCTAACCTAACAAATATTAGAGA ATCTTTATCCTTCATATCTAGTTATGGAGCTCGGCTCCAAGAATTCCAACAATATCAATATTGCATGAATAGCCATATGC GCCTAAGAAAGTTTCCAACTGATATGAGACATAAGTGGAACTCCTTTTAAATTTAAAAGTTATTGGTCCGATTGTCCTAT GTTATATGCATTAGCAACCATTTTAGATCCTAGATGCGGAGTAGATGAGATCGAATCTTTAATGACTGCTACGGCAGAAA ATTTAGGTATTTATATGCTACTAACTATTACTGATGCTAGAAAAATGTTAGAAAAATTATTTAATTTGTATGAAGTAAAA TACGGAACATGTCAAAAAGAACATGGAACATCGATGTCAACAAGCAGTTCGAGACCAAAAAGCTCATTGTGGAGCTTCTT GAAGAAGAAAGAGAAAACACCAGGATCGTCATCAACATAAGCGTCTACCGAATTGATAAAATATTTTGAATCAAATTTTA TAATCGATGACGACAAACTGGACATCTTACAGTGGTGGGGGAGCAAGACTGATCATTTTCCAACACTGTCCGTAATAGCC TGTGACATTCTGACAACTCCAGTGTCAACGGTAGCATCAGAGCAAACATTTAGTGCAAGCAACTGAATTCTTGACGAGTA GAGAAGTAAAATGTATCCGGATTTCTTGGAGGGACTAATGTGCATTAAAGACTGAGAAGATGCCAGAAGACGAAAACAAC AATATACATATGATTCAATTCAAGAATATTTTTTTAACTTAGACATAACAAAATTTTCTGGAAGCACTTAGGGTTTGTAA TTTACTTATCCTAGAATAGTGTACTCTTTTTTCCTTCAGTAAGGTTTTGTCCCGATTTCCCTACGGATTTTACTTGGCAA GGTTTTTAACGAGTTAGTCATTTATGTATATTTATTTGTATTATCTCAATTCAATAAAATTACATCTTTTGAGGGCATAT GATATATTTTCTTTTTTTTAAATTAAATATTACAAAAAAAATTTAAAAGGGTCAGGGTCGGCCCATGAAGGGCCTGAGCT CGGGCCCAACACTAGTCCTTATGGACGAGGGCATGGGCCAGTGCTGAACCTGAGGGTCCTCCCTCAGGCCCAGCCCAGGC CCGTGGC