>DTA_6_1_Mno length=6157;Class=DNA transposons;Order=TIR;superfamily=hAT; TAGAGTTATCAATTGGGCCTGGCCGTCTACAGTGTTGGGTTCGGTATGGCCCAGTCCTGTACTGTTATGGGCTGGGCCGG CCCAGCCCAGCTCATCACGTGGGCTAGGGCTGGGCCTTAATTCTCCAGCCCGCGGCCCTGGCACAGCCCTGCCCAGCACG GCGCGGTCGGTAGCGTGCCTAATAGTCACACGCGACCGGGCACGTCACGGGCCTAACGGTCAGAAACGACTAGTCCGGCC CGGCCCGTGACATGCCCAACGGTAATAATCTGAAAATTTCACACCAAAACCTCTATAAACACCCCACATCCCTCACAATT AGTGCTGCAAATTCGGGCGGCGGGCATGCTCGGTGCCCAAAAATTTTTGGGCACGGCGGGCAGGTGCCTCTCGCCTCCCG ACCATGGAATTTTCTGGCACCGGCTCAGGCAGCCCAAAAATATTCATCCCCCCCGATTGCTCGCCGCCATGGAGAAGTCG TTGCCCGCCGTTCGCCGAAATTTTTTTGAATTTTCTGGCATTACCCGAGTTGCCTGAATTTTTTTTACCGTTGCCTGAAG CCTGAAAAATACCTGAATTTTTTTGACCATATGCCCGAATTTTAAACCAAACGAATCTTTTTTGCCCGAACCCGACCCGA ACCTGAATTTTGTCTGAAAATTCAAACCCAACGGTCAGATTTTTTACCGTTGCCCGAACAGCCCGAAAATTATACTAACC ATTGGACCCGAATTTTGAGGGAAAAAAAAATTTTTCAACCGAAAAATTTTCCTATAAATACCCCCCCTCCCCCCAACCAT TTTCCTCACCCAAAAACTCTCATTCTCTCTCAATTTCTCTTAATCTCTCTCAAATCTCTCTTAATCTCGCTTAAATCTCG CTCGATCTCCCTTAATCTCTTTCAAAGCACTCTCAATCTCTCTTATTTTTCATAATGGCTTCTTCTGGTTATGGTGGTGA TATTCCCATTGATGCCTAATTCAACATCGAAGAAGGGCAATTTCCTAATGTTTTTTAAACGCATGAATAGTAAACTATGG AAAGAGTTACTGATGAAACTGTAAATCTGACCCCTGGTGGACATACTAGAGGTCGGGAACGTAATGGTGGTGGCACTGGT GGCCATGGAGGATAGGCAAGCGATAGTGCTAGTGCAAGTGTTGCAAGTTCTAAGAAGAAATGCAAGCGCACCTCAGCAGT TTGGGAGCACTTCAACACATTCGAGAAGGTTGACAATAACGGTAACATTAAATACATAGCTCAATGTAAATATTATGGTG AGAAATTACAAGGTAACACTATTCACGGCACTACACACTTAAGAAGACACTCTGAAAAGTGTCTTCAATAGCAAGGAGGC GGAGCTGATCTCCGCCAAATGCAATTATCATTTGACCGCCAAACCGGCGGGCTAAGCACGTGAAAATACGATCCGCAAGT TGATCGTATGAAAATGACACGATTAATGGCCACATTAGATCAACCACTAAGTTTTACTGAACAAAGAAATTGGCAGCGTT ATATTAAAATTGTACATAATCCTAATGCACAATTTTTTTCTAGAACTACTCTTAGGAAAGATGCATTAAAATTATATAAA CAAGAAAATGAAGCATTAATCAACCTTCTACACTCTACTAGCGGTTGCGTTGCGTTAACGACGGATATTTGGTCTGTCAT TGCCAACAAGGATTATTTAGCTGTAACCGGACAATATTATAAAGGTTTTGATTTGGATAAGTGAATCTTAGGTTTCAAAT GTGTTAGAGGATCACATACTGTCAATTTAATATAACACAATTTTATCTGTTATTGATGAATATAGTTTAAGAGATAGAAT AATGGCCACAACATTAGATAATGCAACTGCGAATACTAAAGCAATAGAACTTTTTGAAAATGATTTAAGTTTATTCGGTA ATAATGATATACCCGCAAGATAGAACTCCACTTATATAATGCTTGAATAATGCATCCCCTATAAAGATGCTATAACAAAC TTTGTTAGTGCAAAATTAGGACCAGGATTTAGACGAAACTGATTGGTAAATTGCCGAACTCTTGTATAACTTTTTAGGCA GATTTCACGAAGTTACTTTAAAGCTTAATGAAACTTATTACCCAACGTCACCATTAGCGTTAGGAGAACTTTTAAGAATA GTTATTTTATTTAGTGAATTTAGGACACACGAGATTTTAAGAGTTCATATCACTTCTATAGAAAAGATGTTTAAAAAATA TTGGTCTAAATTACCAATGTTGTATGGTTTCGGTATTATTTTTGACCCTAGATTAAAATTAGATGCTTTAGAAAGTGGAT TAGAAAACTTAGGTGACTTTTTAGATATCGACACTTCTGACCAATTTCCTATTATAAAGGAAAAAATATTATATCTCTAT AGCTATTATGAAAGTAGGGTTAGAAACACACATAGTGTAGAACAACCGCAACAACGAGACGACAATCCGCATTCATTCTT GAATGTTTTCAGGTTGAAGAGAAGAAGAAGAAGACGACGATGACGACTCAAGGTCAAGAAGAATCTGGGAGTAGATCTTC ATCAAGAGGTGGCGGCAACAGCGGTGGCTTCAACGAGTTAATGACGTACCTGAGTAAGGGCTTAGATGTAGACAATAGTG ATGAGTGAGGGCTTAGTTATAGACAGTAGTGAAATGTTTGATTTGGTTGAGTGGTGGAGGGCACGAGCATTAACTTGGTC GATCCTAACATGACTGGCAATGGATATTTTTTCGATCACGGTCTCCACTGTTGCAGCCGAACAAGCATTCAGTACAACCG GCCGAATACTTGAAGAACGGAGAAACGCATTACAGCAGTATATTGTTGAAGCTTTGGTGTGCATCAAGGATTGGGACCAT TCCGACCAACGCTTACATGATACAATCTCACTGGCAAACTAAGAATGGATCGGCGAATTTAATAGATTAACTTTTAATTT TCAAGACGATCCTTCTGCTTCAAATTAAATTTTATTATTCTAATTTGTAAATATTTATTTACATTGTAATTTCTAATTTG TATAGTGTTATTGTAATCTTGTATAGACTTTATAAGTTCGTCAAATTTGTAATTCATCCCAAAATGATTGCACTCTTTTT CCCTTACCAAGTTTTTATCCTAATTGGGTTTTTCTTGGTAAGGTTTTTAACGAGGCAATCATGAATTACAAATTTAAAAA TCAATGAAGAAATAATTTTTTTATATAGTTTGTGTGTTCATTTCAAATTTCAAATTGTAATATACACATTGTAAAAATAC AAATACAACATAAAAATATAATATAAATTTTTTTTTGAAAATTCGGGCATCGGATAGCCCAACCGGACACGGGCAAGCAC CCCCTGCCCGAAGCCCGTCCATGGGCAATTTTCAGGTCTGGTTGGGCATCCTGAATTTTTGGGCAGTTCGGGTTCGGTAC TCTGGCAAAAATTCAGACTTTTCAGTGGTCACGAGCGGCCCGTCCAAAGTTTCAGCACTACTCACAATATTCTTCACATT TCTACATCTCTTTCAACTCTCAACTCCTCTTACTCTCATAACTCTATCTCTCATATTCTCTCTCAATTCCTAACTTTCTC TTATCTGTTTCATTTACAATTTTCAATCAAATTCTGCTACATCCCGAAAAACAAAGGTACTGACGTACCGTTTTTATTAT TTTTTGAATAATATTTTATTTCTACTTAATGTTTGCTTAAATTGTTTATTGTTTATAAACCCTTTTGTTAACATTAATTT ATGTTTTTTTACAAAAAAATGGCAAAAGGAAATTTTCCTGATTTCCCTGATTTTGGAGATCAACCATTTTTCGAGGATGA AATGTTGATGGACAACTCCAACCCCACTGATCCAGATAATGTTCTGACTGATAATCAATCAAAGCACAACAAGAATGTTG GAGAACGTGCTAGGGAAAAAAGACGGTGAACTGCTCCTACATGACAACGTTTCACTGAAGAGCTACAACCTAATCCAAAA TCAAGTGAAGTTAAAATGTGTGTGGTATGTAAATATTGTAAAAAATACTTTTCTAACAAAAAATGTGGGGGTATTGGCCA TCTTGATAGACATTGAAAATCATGTCTACCATTACACCAAGGTGGTAGTGTGGACCCCCACCAACAAACACTTTCACTCA CATCAGAAGGTTTACAAAATTTTACATATGTTGCACAACGTGCTCGTGAGGCACTAGCTAAATTTTTAGCTAGTGCCGAA TTACCTTTGTCTTTTGCAGATGATTAAGCATTTGAAGAATTTATTCAGACAACATTCTGTCCACAATTTAAACGTGTAAG TAGAAACATAATTAGAGCTTATTGTACTTCTAATTTTTAGGAGGGGTGTAATAAAATTAGTTATTTAAGCATCACGGTGC ATTATGTTGATGGAAATTGGGTTTTACAAAAGTGAATAAATAGTTTTCATTTATGTTCATTTCCACATAATGTAAATGTT ATTTTTTCAACTATAATGGAAATTTTTAATTTTTGTGGCATTGAAGATAAAGTTTTAACAATTACTTTTGATAATACATC AGCTAACACAACTGATATTAACATGCTTAAAGCAAATTTGAAACCACCTTTTGGTGGCAAATTTTTTCATCAACGTTGTG CATGTTATATAACAAAAATTAGAGAATCGTTATCTTTCATATCTAGTTCTGGAGCTCAGCTCTAAGAATTTTAAAAATAT TGCAGAAACAGCCAGATGCGGCTAAGAAAGTTTCCAATAGATGTGAGACATAGGTTGAACTCCACCTACTTAATGTTGAA AACTGCAATTCTGTATCAACAGATCATCACTACATACGTGAACAGTAAGCATGGTGAGCATTTTAAGCATTTTATTTATG ATGCATATTGGAAGATTGGTGAGTACTTTTTAAAATTTTTAGAAGTATTCTACAACGCTACCGAATTATTTTCTGGTGTT TATTATCCTACTGCACATCTAGCTTTGCATCATTTATTTAATATTTCAGAAACATTTACTTATTATTAGGATACTGATCT TTTTGCACCCATAGTTTTTGAAATGGAAGTTAAATTTAAAAGTTATTGGCAAGTTATCCTATTTTATATGCATTAGCAAC AATTTTAGATCCTAGATGCAGATTAGATGAGACTGAATCTTTGTTGTCTGCTACAACAGATAATTTAGGTATTGATATGA AACTAACCATTGAGGATGCTAGGAAAATGTTAGAACACTTGTTTGCTTTGTATGAAAAAATATACGTAACAGGACAACAA GAACAAGTAACTTCAACGTCAAGGAATAGTTCGAGGCCTAAAGGTTCATCATGGAGCTTTTTGAGGAGGAAGGAGAAAGC ATCGGAATCGTCATCAACACAGGAACCGTCTTTAGAACTAGTCAAATATTTTGAATCAAATTTTGTAATTGATGATGACA AACTGGGCATCTTATAGTGGTGGAAGAGCAAGACATATCATTTTCTAACACTGTCCATGATAGCACGTGATATTCGGATA ACTCCAGTATCAACGGTAGCATCGGAGCAAGCATTTAGTGCAAGCAATCGAATTCTTGATGACAAGAGGAGCAGAATGTA CCCAGATATCTAGGAAGGGCTATTGTGCGTGAAAGACTAGGAAGATGCCAGAAGACGAAAACAACACTATACAGATGATA CACTTCAAGAATATTTTTCAAACTTAGACATAACAAAATCTTCTAGAAGCAATTTAGCCACAGTGTAATGTACTTATCCT TGTATACTGTACTCTTTTTTTCTTCGCTAAGATTTTGTCCCGATCTCCCTACAGGTTTTACTTGACAAGGTTTTTAACGA AACAGTCATTTATGTGTACTTATTGATATTATTTCAATCAATAAAATCACATCTTGTGAGGGCATGTGATATATTTTCTT TTTTTCATTAAATATGATAATAAATACGAAAAGGGTCAGGGCTAACCCGTGAAAAGCTTGGGCCCGGCCCTGGCCCTTAT GGATAAGGGTCTGGGCCAAGGCTGGGCCTGAAGATCTTCCCTCAGGCCTGGGCCAGGGCGGGGCTTGAGGGTCTTCCCTC AGGCCCGGCCTAGGCCCGTGGTGGGCCTAGGGTTAGAAGGGTCGTGACGGCCCGATACTGCCGTTTTGACAACTCTA