>DTA_5_1_Mno length=5179;Class=DNA transposons;Order=TIR;superfamily=hAT; TACTTGGTGATGGTTTTCTCAAATTTGCTGTTGCAAGGCATCTTTTTCTTTTGCATGGTACCCTTGATGAAGGTCAACTC ACAAAGAAGCGATCTAACATTGTCAACAATTTGAATTTATTCAAGCTAGCATGTAAGAGGAACCCAATTTTGGGTGAATT TTGGTTTGAAAAGGAGGCTGGTTATTGAAGTTATTGGAGCCCAATTTTGTTTTGAAGTTTTGTTTGTGTTTTTTTGTTCA ACCATAGTGTAAGTTTTTCTCAGTTGCGTTCTGTTTCTCTTGAAACGCATTGTTAATTAATTGTATGAACATTGATGGAG AGATGCTTTTAAGAATTTTTTGTTGTTATTGACAGATATAGAATTAAGAATTTTTTGTCATTGTTGATGTCTTCATCAAC TCAAAAAGATTGTGAAATAAGCGAATCCCAACCTCAAAATGAAACTGAAGATGTTGTTGCTCCCGATACAGGCTCTCAAG AGGATAACGTTACTACTAAGAAAAAGAAGGCGAGGACTAAGAGTCCAGTTTGGGACTATTTTAAGGAAGATCCTGACAAG AGTAAACTTGGAAAGCCCAGACTGAAATGCATTTTATGTGGATCCTCTTACACTGCTGACACAAAGCGTAATGGCACCTC TAGTTTGTGGAATCACTTACAGAATTGCAAGAAATATCCATACAATCCTCAAGATAAACAACAAAAGCTCTTTTGTTCAA AAAGAAGATTGTAATAGGATCGGACGGTTAGGAATAGGAAATGACAAGTACTTTGACTACGGTGTCATGGACCAAAGAGG GATTTAGGAGAGCTCTCGTAGAGTACATTGTGCTTGATGAGTTGCCTTTTTGGCACGTGGAAGGTAAAGGTTTAAAGGCT TACTCTATGTACATGAATCCAAGGTTTGAGGAGGTGTCAAGGATAACAATTGTGAGGGGCATATATCAAATGTTTTTAGA TGACAAGAAAGAGTTGAAGAAGGTGTTGAGCAAGCATTGATTATGTTTGACAACTGATACGTGGACATGAATTTAGAACA TTAGTTATATATGTGTTTAACCACACATTGGATTGATGATGATTGGAGGAAGCAAAAGCGAATTATCAACTTCTGCACAG TTCCGAATCACAAGGGTAAAACACTTGCGCAGGAGATTGCTAGTTGCCTAAGTGAATGGGGAATTTTGAAAATTTTCTCA ATTACAGTTGATAATGCTTCCTCAAATGATGTTGACAGGGGCTAGTGTTAGGACAACTTTTAGGAGTCCTTGGAAAGCCA TTCGGGATCTGCAGAATGTTTTTAAAACTCATGCTAACCTGATTGTGGGGAATGGGAGGAGAATTAGAATTTGGGAGGAT GAGTGGAGGGGTGGGGGGCCTTTTTCAATCCGTTTTCCAAGCCTATATAGACTTTCTTCTCTTCACAATGCTTTGATTTT TTCTTTTTCCTCTCTGGACCCTGTAGGTAATCTTTCTTGGAATTTCCATTTCAGGAAAGATCATAGTGAGAGAGAATTGG TGAGTTGGCAGAATCTTTGACTTGTTTAGGGGGAGCTTAGATTAAGTGAATTTATTCCTGATAGTAGGGTTGGCAATCCG GATAGCGACATGACGACACGATTCGAAACCCGCACGAAGTTAGCGGTTTTGGATTTACTATAAATGAGTTTGGGTCATAA TCGGGTTGACACGATTAACACGATTAATAAATAGGTTTGGTTAGGGTTGACCTCCTAGCACGAAGTGATACGAATTGACA CGATTAACTATATGCGTTATCTGCAATCTAATGATATGTGATATAATATGAAAGTTTATATGACATATTAAATACAAGTA ATATGAATTTTAATATTTGCAGGTAAAATTCATTTATTTTTCTTAAAGGAAAAGATAAATTGATCAATAAATATGTTAAA CCTGTCTTGATTGTGTGAAATAAGTCATTATTATATTAATTATTGATTTAATATATTAATTTAAACGTGTTATATGGGTT GACACGATTAACACGATTAATAAATAAGTCGTGTTTGTGTTAACATTTTTGACACGGTTAATAAACAGGTCGTGTTTAGA TTGATGTTTTCTGACACGATTAATAAACGGGTTGACACAGATACGACCCACTAACACGAATTGCCATCCTTACCTGATAG ATGGTCGTGGGAGTTGGATAGTTCAGGGCTTTTCTCTTGTAAATCTCTATTCAAGTCCTTTATTGATGATAATGCTTACC CCGATTTTAGTTTGTGTCACTTTATTTGGAAAGCCTCAATCCCTACTAAAGTCTTGTGTTAAGGAAGCTCAATACTCAGG ATTTGTTGCAGAGGAGGAAGCCTTACCTTTATCTCTCCCCTGGATGGTGGGATGAGTGGAGGGGTGGGGGGCCTTTTTCA ATCCGTTTTCCAAGCCTATATAGACTTTCTTCTCTTCACAATGCTTTGATTTTTTCTTTTTCCTCTCTGGACCCTGTAGG TAATCTTTCTTGGAATTTCCATTTCAGGAAAGATCATAGTGAGAGAGAATTGGTGAGTTGGCAGAATCTTTGACTTGTTT AGGGGGAGCTTAGATTAAGTGAATTTATTCCTGATAGTAGGGTTGGCAATCCGGATAGCGACATGACGACACGATTCGAA ACCCGCACGAAGTTAGCGGTTTTGGATTTACTATAAATGAGTTTGGGTCATAATCGGGTTGACACGATTAACACGATTAA TAAATAGGTTTGGTTAGGGTTGACCTCCTAGCACGAAGTGATACGAATTGACACGATTAACTATATGCGTTATCTGCAAT CTAATGATATGTGATATAATATGAAAGTTTATATGACATATTAAATACAAGTAATATGAATTTTAATATTTGCAGGTAAA ATTCATTTATTTTTCTTAAAGGAAAAGATAAATTGATCAATAAATATGTTAAACCTGTCTTGATTGTGTGAAATAAGTCA TTATTATATTAATTATTGATTTAATATATTAATTTAAACGTGTTATATGGGTTGACACGATTAACACGATTAATAAATAA GTCGTGTTTGTGTTAACATTTTTGACACGGTTAATAAACAGGTCGTGTTTAGATTGATGTTTTCTGACACGATTAATAAA CGGGTTGACACAGATACGACCCACTAACACGAATTGCCATCCTTACCTGATAGATGGTCGTGGGAGTTGGATAGTTCAGG GCTTTTCTCTTGTAAATCTCTATTCAAGTCCTTTATTGATGATAATGCTTACCCCGATTTTAGTTTGTGTCACTTTATTT GGAAAGCCTCAATCCCTACTAAAGTCTTGTGTTAAGGAAGCTCAATACTCAGGATTTGTTGCAGAGGAGGAAGCCTTACC TTTATCTCTCCCCTGGATGGTGTGTTCTTTGTAAAAACGCTGAAGAGACAACAAATCATTTTTTCCTCCATTGCTCTTTC GCTCTGAATATTTGGTATCGTGTTCTGCGTGAGTTTGGGTTGGTGTGGGTTCCCCCAAATAGCATCATGGACCTTTTTGG TAGTGATTTGTTGTTGGAAAGGACTACTCCGAAGAGAAGGCTTTGGAATACAGTTGTTCTTATAGTCACTTGATCTTTGT GGCTCGAAAGAAACAATCGAATCTTTGACGGCACACAAGGAGTCAATAGTGATATTTGGGATAGGATTAAGTATTGGGTA GCTTTGTGGATTTTCCATTCTAAAGGTTTTACTAGTTTGTCTTTCTCAGATCTTCTTAAGGGGTGGGATAGTATATTCCA TTAAGCCTTTTTGTGGATTCTGGTTCAGTAGATGTTTAGGCTTGTTTTCTGTGGTTTGCAGTCTGTGTTTTCTTGGCGGA CCGCTTGGCCCCTTTTGTATTTCTTGTAAAAAAATGATGTTGCTATTGAGAAGTTGAGAAGAAAAAAAAAGGATTCATGG TTTTGGATGGTGAAATGCTACACATGAGGTGTGTTTGCCATATCATCAACTTGATTGTCACTATCGCTTGAAGGATTTGT CCCATTCTGTTGATGCCATTCGCAATGCTGTTAGGTATGTAAGACCCTCCTCAGCTCGACTTAAGAGGTTCATAGAGGTC ATAGAGGAAGAAGGTGTCAAGTTAAAAGCCCTCTTGTGTTTGGATGTTACAACTAGATGGAATTTGAACTACTTAATGTT GGAGGCGAGTTTGAAATTTATTCCAGTGTTTGATATATTGCTTATGGATCAGCAGAATTTGAAGTATTTTAATGAGGTCA ACAAAGGGAAGAAGGTGGAGGGTCCACCCAAAGAGGAGGATTGGAGTAATGCAAAGGTTTTTGTTATCTTCTTGAGAACT TTTTATGACTTGACAAATAAATATAGTGGATCCTATTATGTTACTTCCGATACATATTTTGTGAACAACGGTTGAATTCA TTGGAGTATTGTGAGGATCCTCTTTTGGGAAAGATGGCTCTAAGCATGAATCGGCAATTTGAAAAATATTGGGGTGACGT TGAGAAAATGAATAATTTGATGTTTCTTGATCCAAGATACAAGATGAAATACCTTAATCATTGCTTCAAGTATTTGTATG GCGAAGAGGTTGTAAAGACATTGTCGGCATCAGTTGAAGAGAAGTTGCACATGTTGTTCAAGGAGTACAATGATGTTGCT CCTCCACCTCCCTGTCCTCCCGTGACTCAAAGCAACATACTCGGCTCCCTAAATCCTCAATTACCTCATTTTCCTTTACT TCCTCAACTTCAATACTTGGAAATCCAATGGTGATGAAGGATTGTGACTTGAGTTTGGAGACGACGGTGGAATTGCACAA AAGAATAATGTTGATAGGTATTTAGTAGATGCTCCTGAGAGGATATAACCGTTGTGAACTTTGATATCTTGAAATGGTCG AAGGTTAATTCTTCTAAGTTCAAGGTCTTATCCCAAGTTGCTAAAGATGTTCTCTCAGTTCCAATATCTACCGTCACTTC GGAGTCTGCTTTTTCTACCGGATGCCACATCCTTGATCTCGAAGCTTTAATATGTTTGAAAAATAGGATGAATGCTAGGG ACGAGGAATATGAGCCTGTAGTACTTCGACAGTACATGGATGATGTTGCAAGTTATGAAGATTGCTATGAAGTTGTGCCC GGTAATAGTTTAAAACTTAAAATTATTATCCTTTTTTTCATATGTTTTTAAATTTGTTT