>DTA_40_1_Mno length=502;Class=DNA transposons;Order=TIR;superfamily=hAT; TCTATAAGTATATATGTATATATAGCAAATTAGATATAGCCCCCCTAAAAAATTGAAAATATAATCTTAAAACCTCCAAA AATTTTAAAATACTACTTTCTAAAAAAATACCTCTAAGAATACTACTTTCTAAAAAATACTACTAATCTTAACTTTAAAG CCTTTCATAACTAAGAATAAATAATACATATCTATTAGTTTATCTACTTCTAACATTAGTATTAACTCTACTTCTTGTTA CCGCTATATATGTAGAGAGNGTATTTTTTGTTATGAATATTGTGAAGAATTGACTACGCAATCGAATTAGAGATCAATTG ATTAATGATACTTTACTTNTGTACATCGAGAAAATTATCTTTAATAACCTTGATAATGTGGTTATTATGCAATATTTTTA AGACATGAAATCCCGTCGNGGACAATTTGTAGTAACTTAACAATTAATTTTGATTAAATTTTTGATGTAGTTAAAATTAG TCCCCCTCACAAAAATTTCTAC