>DTA_4N_1_Mno length=1072;Class=DNA transposons;Order=MITE;superfamily=MITE; TAGGGCTGGCAATTCGTGTTTGCGTGTCGTGTTCGGGCCGGCACGATTACGGCACGACACGATTATAGTGAACACGAACA CGACACGATTAATAAACGTGTCAGAAACCCAAACACGAACACGAAACGCTAATAACACGGTTAACACGACACGACACGCG AACACGATTACTAAACGTGCCGTGACGGGCCGACACGAAAAAAACACGTTTATGACCCGTTTATGACCCAACTAGCAAAA ATAGTGGAATTTTATATTGTATTCAAAACTATATTAATTGACTACTTAATATAAAATCATGCATAATAGCCAACACACAT TAAAATATCCAAATATCAAACACACACATATATATGATACTACTAGATTATCAAGTATATATGTTTCAAAACATACCAAT TACCAAACATCCAAAGAAGTTTGAAAACATAGCCAAGTACATTTAAATAAGTTTGAAAACATAACCAAACATTTGAATGT TTAAGTGCATAAAACATAAAATAAATATAGGAAAATGTCTTCTTTGAGCCTTGAGGTTGAATGCCCAACTACGCTCTAAA AACTAAAATTAGTTTCAAGAGACTGAGTCAGAAGTAGGGTTTTGTCTAATATATATATATATATATTGTCGGTTAGATAA AGTCTTTGTATTTGAATTTAAATAAAATAGAGGATAAATGGTTTATCATTAGAGATAAGGTTTCTTAGGTTAGAGTTTAT CTTTAATTAGGATAGTTTCTTTTAGGAAGATAAGGTTTCTTCCTTAGCCTATTTATTCTTATTTTTTACTATTCTGAAAA TAATAGAAGAGAGTTTCTTTCTAGAAAATTTACAACATATATATATATGGGCTTAATAAACGGGTCGGCGGGCCGTGTCG GCCCGATAACGGCCCGTATAACTAAACGGGTTAAGCGTGTTAAACGGGCTGGCACGAATCCAGCCCATTTATTTTCGTGT TATTCGTGTCAGCCCGTTAACGACCCAATTAATAATCGTGCGGTCCAAACCCATTTATCTCGTGTCGTTTTCGTATCGTT TCATCGTGTCGTGTCTGAAATTGCCGGCCCTA >DTA_4N_2_Mno length=965;Class=DNA transposons;Order=MITE;superfamily=MITE; CTGGCACGAATAACACGAAAATAAACGGGTTGGATTCGTGCCAGCCCGTTTAACACGCTTAACCCGTTTAGTTATACGGG CCATAATCGGGCCGACACGACACGACCCGAACCGACCCGTTTATTAATCCATATATATATATATATTTTTTTTAAGATAA AACCCTAGCTTCTCTAATTCTCTTTCTCTCATCTCTCTCATTCTCTCATTCTCTCACAGCCCGTTTTATTTATATTCTCT CATTTGCATGAAGGGTGTTTGATAAAAGGGTTAACTTAATTTAACACTCTAACTTTTAAATAAGTTATGGCATGTTGATA AAATTACAAAATGCCAATGGATTTGTAGATGGATGATTTGTAGATGGACTTGTAGATGGTTGATTACAAAATGCCAATGG ATGATTTGTAATGGATAAACCTAAACTTTAAATATGTTTTATGCTTTATGCACTTAAATATGCCAATGGACTTGTAGATG GTTGATTATGTTTTATGCACTTAAATTTTCAAATATTTGGTTATGTTTTCAAACTTATTTAAATGTACTTGGTTATGTTT TCAAACTTCTTTAGATGTTTAGTAATTGGTATGTTTTGAAACATATGTCATAAGTGATGTTTTAGATATTTTAATGTGTG TTGGCTATTATGCATGATTTTAACTATAAGTGATATTAAGTAGTCAATTAATATAGTTTTGAATACAATATAAAATTCAC TATTTTTGCTAGTTGGGTCATAAACGGGTCATAAACGTGTTTTTTTCGTGTCGGCCCGTCACGGCACGTTTAATAATCGT GTTCGCGTGTCGTGTCGTGTTAACCGTGTTATTAGCGTGTCGTGTTCGTGTTTGGGTTTCTGACACGTTTATTAATCGTG TCGTGTTCGTGCTCACTATAATCGTGTCGTGCCGTAATCGTGTCGGCCCGAACACGGCCCGCGAACACGAATTGCCAGCC CTACT