>DTA_39_1_Mno length=923;Class=DNA transposons;Order=TIR;superfamily=hAT; ATATATATATATTTTTTNTGCTAGATCGAGTAAATTGCTTCNTGANNTGTCAAACATGGACGAAAATTTCGCCGAAATTT CGGTGGAAATTTCGGATTTTGAGGGTCCCGAAATTTTTTTCCACTATAATATCGATATCGGCAAAATATTAAAAATATCG GTAAATATCGGTCGAAATATCGATATCGGTTTGCATATAGAGTAATTGGGGCAGAATATCGAGAAATTTCGGTGATATCA GAAACGAAAATTTTAAAAGGTTTTTTTTTTAATTTGCTTTATAATATATGTTTTCTTGCATTATTTCTTTTGTCATCNAG CAAGGAGAGAGCGAGGAATATCAAGAATGCAAACATCTGATGAAGATAATCTTTTCATGAGTTTACAATCGATGAATTTG GNTTCCAATTATTGCAGCTCTTCCAAGAGACTCCTAACGTTCATTATCCATATAATCATAATTTTAGAAACTATGATAGA TATGGAATTTTNAATTATCCTCATCCGAACATACCACCACCATCTCAGGCAAACGATTGGGAGAATTCACAGTTTCTAAT TCATAAAAATACAGTGGGAAGGGATCAACAAACCTACATGTGGCACGTTCATAACTATGTTCGACATTATTCAAATAACA TGTCATAATACCAATATTGTTTGAATCAAGATGGGATCCCGACCACGTTTGAGCCTCATAGAACTTCCTTTTGGTATTAA GAAATGTAATATGTATGAAGTTTTTTTTTTTATGTAAAACTTGTTTATTTATGTATCTTTTAATGTTNATGCTATCANAA AGTATTAAAAATATGTTCTAACGTAAATTTCCGTNATTTCCGTAAATTTTTTTGATATTTTCTCCGATATTTCCGTAAAA TTGGAGTACCGATATTTCTACCGATACCGATATTTTCATCCTT