>DTA_38_1_Mno length=1222;Class=DNA transposons;Order=TIR;superfamily=hAT; TGGATGAAAATGTCGATGTCGACGGGGTTGTCGAGGTTTTGATTTACGGATAATGTCGACAGAAATGTCGATGTCGACGG ATATTCTGAGAAAAAATAGATACCTTGAGAAAACTTTAAAATTTTTTATTGAAACTGTACAAAATGCTAAAACAATCAAT ATTACTTAATTTGAACTAATTTAATAACAAAAATAATACATTTTTTATCAGAATATGAGAGTTATGTCGAATAGTATAGT AAGAAATTATCATAATTATATATGGATTATGATTCAAATATAATTTTACATACTCATTATAAACAAGGCACAATAATTCA ATATACTACATAGAAATTAACTACCAAACATAATAGAGTACACACAAACTTAAAGTGTTTTCAGTACCAAAACGAGTTTC TAGCAGGTTGGAAAGCATTAGGTAGGTTCTGATCTTGATCTAAACAATACATTTGTCAAGATATTACCCTTGAATAGTTC TGGAGGTAGTTGTTGATGTGCCACATGTATGTTTCTTGATCTCTTCCCATTGTTAACCCATAAATTGGATACTGTTGGTT TATCNAACTTGATGANTAGTCTTCANGGATGTGTAATGACATTTCAACACTGACNTGTGGTGGAGGATACACTAATATAT CANANAAACCATCTTGGTTTTGTACTTCTGAAGTAGATCCCATGTGAGAACTATATGGATAGCCATATGAACTTTGCTCA GTTCCTAAGCTCATGGAATCAAAACTCAAGGCCACAAAATCCTCATCAGTTTGACTCANTTGAGTCACACCACGTCTTCT TATANATTGTTTTCACCATTNAANNGTCACATTTTNTTGAAAAAAACTAATTAAGTCTTAATATTTTCTTTTTATTTAAA CCATGTTGTCACATTTTATTGAAAAAAATAGGAAAAAATGCGCTACAAAATTGATTTTTATTAAAAAAAATTTCTCAAGG TTTTTGGACATTTTGTGGACATTTCCAAAAATATCCTAAATATTTACGGATATTCACNGATNTTACGGATATTTTTGGAC ATTGCGGACATTTTACAGACACGCCGAGAAGAATATCTTTTCCCCCTATATCCATGTCGAGACTTCAAAATATGGACAAT ATCGTGAAAATGTCGACGATGTCGTGGACATTTTCATCCATGATTGCCTANAATGTCAGATATACACTTGTCTAAANTCT AATACACACTAANTAATAGGGA