>DTA_37_1_Mno length=3446;Class=DNA transposons;Order=TIR;superfamily=hAT; AGTGCTGGAACTTCGGGCGGCGGGCNTGCCCGANGCCCGAAAATTTTTGGGCNCGGCGGGCAGGCNCCTNTCGCCGCCCG TCAAATTCTTCGAGCACCCGGGCTCGGGCAGCCCGAGAAAGAGTATCCCCGACAGCCCGCCGCCGGTGGAGAAGCCGTNC CCCGCCGNCCGCCGGATTTTTTTTGAATTTTCCGGCGNNACCCGAAGCTGCCCGAATTGCCCGAATTGCCCATTTTTCGA ATTTTGTGACCGTGCCCGAATTCCCGAATGCCCGAATGCCCGAATNTTTTTTTACCGTTAGCCCGAATNTTGCCCGAATT TTGAAACCCAACAGCTNTTTTTTGCCCGAACCCGACCCGTCGCCCGAATTTTGCCAACCCCAACGGCTATATTTTTTACC GTTGCCCGAATTGCCCGAACCCGACCTGACCCGCCCAAAATTTTGTTACCGTTGGANCCGAATTTTTGGGGGAAAATTTT TTTTTTCAAGCCAAAAATTTTCCTATAAATACCCCCCCTCCCCCCAACCATTTTCCTCACCCAAAAACTCTCATNCTCTC CTAATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAATCTCGATCTCTCTT AAGCTCTCTCAAAGCGCTCTCAATCTCTCTTATTTTTCATAATGGCTTCTTCTGGTTATGGTGGTGATATTCCCATTGAT GCCCAATTCAACATCGAAGAAGGGCAATTTCCTACTAATGTTTTTCAAACGCAGGAATCGCAAACNACGGAAAGAGTTGC TGAGGAAACTGCAAATCCGAGCCCTGGTGGACGTACTAGAGGTCGTGGACGTAATGGTGGTGGGCGTGGAGGAGAGGCAA GCGGAAGTGCTAGTGCAAGTGTTGCAAGTTCTAAGAAGAAATGCAAGCGCACCTCAACAGTTTGGGAGCACTTCAACACA TTCGAGGAGGTCGACAATAACGGTAACATTAAATACGTAGCTCAATGTAAATATTGTGGTGATAAATTACAAGGTAACAC TATTCACGACACTACACACTTNAGAAGACACTCTGAAAAGTGTCTTCAAAAGCAAGGAGGCGGANCCGATCTCCGCCAAA CGCAATTATCGTTTGACCGCCAAACCGGCGGTCTAAGCACGTGGAAATACGATCCGCAAGTTGATCGTATGGAAATGGCA CGATTAGTAGCCACATTAGATCAACCACTTAGTTTTACTGAACAAAGAAATTGACAGCGTTATATTAAAATTGTACATAA TCCTAATGCACAATTTTTTTCTAGAACTACTCTTAGGAAAGATGCATTAAAATTATATAAACAAGAAAATGAAGCATTAA TCAACCTTTTACACTCTACTAGTGGTTGCGTTGCGTTAACGGCGGATATTTGGTCCGCCGTTGCCAACAAAGATTATTTA GCTGTAACCGGACATTATTATAAAGGTTTTGATTTGGATAAGAGAATCTTAGGTTTTAAATGTGTTATAGGATCACATAC CGCCGATTTAATATATAACACAATTTTATCTGTCATTGATGAATATAGTTTAAGAGATAGAATAATGGCCATAACATTAG ATAATGCAACTGCGAATACTAAAGCAATAGAACTTTTTGAAAANGATTTAAGTTTATTCGGTAATAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAGGTAGTAATCAAAGAATACAAGATTGGTTTAGGTTTCTACAAGCATGTAATCAAAATCC TAGAGCATTAGCCTTAGATATGCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAT ATTNTCTCTCTATAGCGCTTNTGAGAGTAGGTTTAGAAACNCNGCTCGTGNAGTACAANAACCGCAACAANAAGACGANA ACCCGCATTCATTCNTGAATGTTTTTGGGTTGAAGAAGAAGAAGAAGACGACGACTGAAGGTCAAGAAGANTCTGGGAGT GGANCTTCATTAAGAGGTTGGGAGTGGCANCGGCGGCTTCAACGAGCTNATGGCGTACCTGANCGAGGGCTTAGTAGTCG ACGATAGTGCTGAAGTGTTTGATTTGGTTCAGTGGTGGANGGCACGGGCATTAACTTGGCCCGTCCTAACTCGACTGGCA ANGGATATNTTTTCAATCCCAGTCTNCACTGTTCCATCCGANTAAGCCTTCAGTACGACCGGNCGAATACTTGAGGAACG CCGAAACGCATTGCAACGGGACATTGTTGAAGCTTTGGTGTGCATTAAGNATTGNGATCGTNCCGATCAACGTTTACAAG ATACAATTTCGCCGGCAAGCCAAGAACGGATAGATGAATTTAATAGATTAACATTTAATTTTGAAGACGATCCTTCAGCT TCAAATTAAATTGTAATTTNTAAATATTTATTTGCTTTGNACATTGTAATTGTAATATTGTATATTTGACTTTGTAATTT TGCAAAATTTGTAATTCGTCACAAAATGATTGCACTCTTTTTTTCNCACCAAGATNTTTANCNAAACAATCATGGGTTTC AAGTTTTTAACAAGACAAAATTACAAATTTAAAAATTAATAAACAAAATTAATTTTTTGAATTGGTTGTGTGTTATCGAA TTTCGAATTGCAATCTTAATTATAGTTTTTATATAATTTTTACAATAAATAACTTAATAATTATTTATATACAAATACAA TTAATAAACAATATTATATATAATATATAAAATATTATAAAATATATAAAAAAAAAAAATNCAGGCATTCGGGCAGTCTC GGGCTGCCCGACCGGGCTCGGGCAGCCAAGACCTGCCCGAAGCCCGTCCAATGGTATTTCTNGGCTCGGGTCGGGCAGCC CGAANTTTTCGGGCGGGCTCGGNCANCGGGCANAAATTTAGNNTTTTCAGGTGGTCGCGGGCGGCCCGTCCAAAGTTCCA ACACTA