>DTA_36_1_Mno length=2507;Class=DNA transposons;Order=TIR;superfamily=hAT; CTCAAATTATAAACTCAAATCAGCGAAGTGAACGGGGCCCTCGTCTTTCAAGAATGCAAATTAGACAGTTATCCATAGTT TGTTATGACTAATGTTGTTGACTTGCTTCATTGTAGGTCGACGTACAGAACCACACAACATTTTTCTTATCCTCAGTAAG TTTAGCAATGATTAAGCTGTAATAATTATTACTAGAGTGACAACATACTAGTGTTGTTCTAAATAAAAATTGGATTAATT TCTGTGTCCTTCACATTTCCAAATGAAAATTTGTAATGAGTATAACATTTCAAGTCAAAAGCTTGAATGGATTTGTGTTT TGATGCGTGAAAATCTAGTTGTTGGAAGTATAGGAACTATGAACTTCGAAAAATGTATTGATTTATCTGCTTATATTGTG ACAGTGGTACGAGAAAAAGATGTTTGTTGGGAATATGCTGAAAAATTAGATGGAAACAAGGTGAGGTGTAAATTCTGCCT GAGAGTTCTGAATGGAGGCATTAGTAGGTTGAAGCATCATCTCTCTAGGCTTCCAAGCAAAGGCGTAAACCCGTGTAGCA AAGTAAGGGATGATGTGACTGATAGGGTGAGAGCTATTATAGCATCAAAGGAAGATGTTAAGGAAACATCTAGCACCAAA AAGCAGAAGCTGGTGGAAGTGAAATCTCCCGGAAATGTTTCTGCGAGCAAAGCCCTTGTGTCTACAGACACAACATCTCC GGTCGCAAAAGTTTTCCCAGCTGTCACTCCCGTAGCTCCTCCCTCTTTGAACAGCCAAGAAAATGCGGAGAGAAGCATTG CCCTGTTCTTTTTTGAGAATAAGCTGGATTTCGGTATTGCTCGCTCTTCGTCCTATCAGCTAATGGTTGATGCCATAGCA AAGTGCGGTCCTGGATTCACCGGTCCATCCGCTGAAACTCTCAAGACTACATGGCTGGAAAGGATCAAGTCAGAAATGAG CCTACAATCAAAAGACATTGAGAAAGAATGGATGACAACAGGCTGCACTATAATTGCCGATACATGGACTGACAACAAAT CAAGAGCTTTGATCAACTTTCTAGTTTCGTCGCCCTCCAGGACCTTTTTTCACAAATCCGTTGATGCATCCGCGTATTTT AAGAACATGAAATGCCTTGCTGACTTATTTGATTCAGTCATTCAAGATTTTGGCCCGGATAATGTTGTACAGGTTATAAT GGATAGCAGCTTCAACTATACCGGTGTCGCAAACCACATTTTGCAGAATTATTCAACGATTTTTGTGTCTCCTTGTGTTT CTCAGTGCTTGAATCTAATCCTAGAGGAATTCTCAAAGGTAGATTGGGTGAATAGATGCATTTTACAGGGTCAAACCATA TCAAAGTTCATATATAACAGTGCCTCTATGCTTGATCTAATGAAAAAGTACACTGGAGGACAAGAACTCATTAGGACCGG TATTACGAAGTCTGTATCCAGCTTCCTTTCACTACAGTCTATCTTGAAGCAAAAGTCGAGGTTGAAGCATATGTTTAATA GCCCTGAATACTGTACAAACTCCTTGTATGTAAATAAACCACAGAGCATATCATGTATTTCCATCGTTGAGGATAGTGAT TTCTGGAGGGCGGTGGAAGAATCCGTGGCCATATCCGAGCCTTTTCTGAAAGTGTTGAGGGAAGTCGCCGGAGGGAAGCC TGCGGTGGGTTCTATATACGAGTTAATGACAAGGGCAAAAGAATCTATAAGGACGTACTATATAATGGATGAAAACAAGT GCAAGACATTTTTAGACATAGTAGACAGGAAGTGGCGAGACCAACTCCATTCACCTCTACATTCAGCAGCAGCATTTTTG AACCCTAGCATTCAGTACAATCCAGAAATAAAGTTTCTTAGTTCTATAAAAGAAGACTTTTTCAAAGTTCTGGAGAAGCT ACTCCCTCTTCCCGAAATGAGACGCGATATCACCAGCCAGATATTTACTTTCACAAAGGCGATGAGTATGTTCGGCTGCA GCCTAGCTATGGAGGCGAGAGATGTGGTTTCACCTGGTAAATTTACAATATGCATTCATTATATATCTGTATCTAGGTGT ATACCTCTGATAAAAACATATCCATCTACTATGACAGTGCTCCATTATGCGTGAAACCCTTCTGGTTTTGCTCCTTAAAT CCTTGAAGAAAAGAAAGATTGTCATGCTTCAAAAAGTACATGCCAAGTTAGACAATACTGTATATCCGACTTGGTTTGCA TTTCCGTTTTCTCGCTATATATATTGGATTTTCAATGTTATTGGTAATTCTTTTACAGGGCTTTGGTGGGAACAATATGG TGACTCTGCGCCCGTGTTGCAACGAGTTGCAATCAGAATACTTAGTCAAGTTTGCAGCAGTTTCACTTTCGAGAGGCATT GGAGTGCATTTCAGCAAATCCACTCCGAGAAACGCAATAAGATCGATAGAGAAACGTTGAATGACCTTGTGTACATAAAT TACAATCTCAAGTTAGCTAGACATACA