>DTA_35_1_Mno length=5532;Class=DNA transposons;Order=TIR;superfamily=hAT; CAAAGCATTTAATTTTTTTGGAAAAAATCAACGTTTTTCCTTTAAGAATTATACGTGCTAATCATTGTTAATGATCAATT TTCATGTGCTCTTTTTTTTAGGAGAAATTGTACTTTTTTTTTTCTTCTAAAAGTATGATTTTTTTTTTTTCACTTCTTGT TCTTGCACTTTTATGGTATGACCAAATAAATTATATAGAAGATTGATAATTTGTTCTTATGTTGAAAGTAGTCACAATTT GTTTATATGGGAAAAAGCCTTATAATATAAGATAAAAAAAAAAAACTAGTTTTGTCAGACATTAACAAGTGATTCAAAAT GTCAAGATCTCAAAATAAATCATAATACTTTTTATGATATCCTAAAAAAAAATACCATAGAAAACTATATATTATGTCCT ATATCGAAACATTATCACAATCAAGATCAATTATCTCCTCAGTTGCTACATTAGAGCCCACAACTTCACAAAAGTGTTCA ATGCGTGATTTATAAGCTTCTTTCCATCCATCTGCCCACGAGTCATGATACTTATACCAATTGTTTGCTATATAGGCGGG ATAGGGTGACTTGGGGATAAGAACACCTATAATAACATTGTAAACACGTAAAATAGCTAATAAAATGTTTAACTTGATTA TTATTTTTCTAAAAGTGTCAATTAAGTTACCTCAATAAATGATTTCCGACATAACCGATAGCAATATATTTTCCAAAAAG CAATTGCAGCGGCTCTGATCTCAGTGGTAAAAATGTAAGGCATTGATGCATCCATGAGTGAATTAGGACAACATTGACTT AGTTTGATATTGTTTTTCCCTCTTAAAATCGGCTTCTGTTAAGTAGAAGTCGATTTCAGTGTTTAGTAAATCTCCTTAAA AGTACTTTATTGAAGAATTTTTTAAGAATCTACAGCTAAAATCAGAAGTAGCTTAAAGACATTTTAATTTTTAAATTATG CGGGAATCGGCATAGTATAATTAATGATAATTTTTTTTGTATTATATTATATATAATAATAAATATATATTATATTGTAA TTATATATATTATATTATAGTATTCATATCAATTTAATATCATAATTTACCAAACACTATTATACTGATTTTGGACCTAG CATAGCTACTATAATTATAATTTACTAAACACTCAGTTATTTTTTATAATAACTGTTACTTTTTTCAACACAATTAAAAA TATATTTTTTAAAATCTATAGCACTATCAAACTAAACTATTGTACCATGATGCTATAAGATGCCCCACGTCAGGCATAGT CATCAATCCATCACTGGAGCGTTGCTTTCATAAAATTGACAATGAATGAATTAACTCATTCAATAAATCTTTCCACATTT GAATCCATCCATCCTCACTCATGCCTATCAAACTAGATATAGCTCTAAATCCACAATTACCATCAGCGATAACATCTTTG ATACGTGCAATGTATGGCCTCAATCCTTCCGAAAATGAACTAATATAAGCATTGGAAGTCATTGAATGTGCCTGAGATGC CTACAAAAGTATGAATATTAGTGGATATCGTTTTATAATAAAGTAAAATAAAATAAAAAAATGGTAGATTAATTGCCTTA TTCTTTTGTTTTCTCTTATTTAACATAACAATCTTAGCTGATTTTGTTTTAGCCATACTTGAAAAAATAGTGGGTTAGCA ACTATTATGGATAGATGATGTAGGCTCAAACGTAGATGGGTTTCGACGCGTGGAGGTATCAATCTTTGATGGTGGTCAAT GTCGGGTTAGAGTTGTTAAATGATTCGGGCCGTTCCCCAGCTCATAATAGTGTCAGGTTCGGCACAGCCCAGTACGGTAC TGTTACTGGCCGTGCCGGCCCGGCACGTTATACGGGCTAGGGCTGGGCCTTGGCTTCTCAGCCCGCCCTTGAAGCCCGTG ATTTGACCCATGTTTGGCCTGGCCCAGGCCCGTGTTCGGCCCGTGAATCGGCCCACCAAGCACTCCTACAAGTGACTGTT GGGCCCATCGTGTACCCAATAGTCACTTGCGGAAATTGTTCAAAATAAACCCTTATAAATACCCATAAATCCAACACAAC ATTCACCACAACAATTCACTCTCAACTTCTCATCTCACTCTCATTCTACATCTCATATTGTCCATTTGATATTGATTCTA AGCTTTTCTCTCTTGATTCATCATTTTCTTGCTCTTTCATTTACAAAGTCAAATCAATTTGAAGAAATCCTGAAAAAAAA GGTATTCTACTTATCAATTTTGTTACATAACATTGTATTACTCAAGTTTATTTATATTGTTTATTGTTTATAAATGAGCG GATTAACATTAGTTTATGTTTTTTTTTCTTGTTTCAAAAAATGGCCGCATCAAATTTCCCTGATTTCCCTATGCTCCCTG AGCTTGGTGATGAACCATTTTATGAGGATGAAATGTTGGCCCACAACTCCAACCTAACTAAACCGGAAACAATTTCGGTT GATAATGCTTAGGTGCACAACGAGGAAGTTGGAGAACGTGGCAGGAGAAAAGACCGTGAACTGCTCCCGCATGGCAACAT TTCATAGAAGAGCCTGACCAAATCCAAAAACAGGTGAAATAGAAATTCGTGCGGTATGTAAATATTGTAAAAAATATGTT TCTAATAAAAAAGGTGGGGGTACTGATCAGCTAGATAGACATTAGAAAACATGTCTACCGTTGCACTAAGGTGGCAGTGT GGACTCCCACCAACAAACACTATCACTCATATCACAAGGGTTGTAAAATTTTACATACGATGCATAACGTGCTCGTGAGG CACTAGCTAAATTTTTAGCTAGGGCCAAATTACCTCTGTCTTTTGCAGATGATGCAGCGTTTGAAGAATTCATACAGACG ACATTTTGCTCTCAATTTAAACGGGTAAGTAGAAACATAACTCATTTTGATTGCATGAAAGTGTTTTATGCAATGAGACA ATCCCTAGTTGATAATTTTAGGTCGTTTAATGCTACTATATCTTGTACTTCTGATCTTTAGGAGGGGTGCAATAAAGCTG GATTTTTATGCATCACGGTGCATTATGTTGACGAGGAATGAGTTTTACAAAAGAGAATAATAGGTTTTCATTTATGTCCA TTTTCTCATAATGCAACTGCTATTTTTCAACTATAATGGAAATTTTTAATTTTTATGGGATAGAAAATAAAGTTTTAACA ATTACTAATGCATCAGCTAACATGATTGTAATTAACATGTTTAAACTTAACTTGAAACCACCTTTTGGTGGCAAAATTTT TCATCAACAGTGTGCGTGTCACATAATAAATTTAGTAGTATAAGTAGGAATTGAACAGATTTCCTCTCATCTAACGAATA TTAGAGAATCTTTATCCTTCATATGTAGTTCTGGATCTCGACTGTCACGCCCCCCAAACGAGGTGGGTGACGTGGAGCTC GATTGGAGATTAATAAAGCAGATTCCCAGACCGGGCCCCACACTTAACTGCATTAAAATATAAATAAATTACAAAATCCC AGAGCCTCTGACACACAGGGCTCTACCCCACATGACATACAGTATCGTACATACATGAACATGTAATTAATCATTACAAC AGACATCAACCACAGTCTAGTAAATCCAAATATTATATAAGTTTACAGAATTTCTCAAATTCCTTACATTTGTCCAAGAG GATGTCCACGATCCTCACTTGATTCCAACAGCAGCACAACTCAGCTGCTCCGTAGCAAATATCCAGCTACTGTGCACCGC TCCTAGAATCTCCTGGGAGGGGTTTAGTACATTTAAAACATAAAACGTGAGCGAAAGGCCCAATAGGATATAATTTGAAA TAAACGTTATAATAAATGTACGAGGGAATACATAAATAAATAAGTAGATAAAATAAGACATTCAGTCCCGACAGAACAGC CGGAACCTCACATCCTTTTTCTCAAAGGAAATATAACCGTAAATAACCGTTTTACAGGCTTCAGTAAGTAATTAGTACAA ATTACTTACCTAACCAAGTGCCTCGCCTACCCGGACCGAGTTTCGGGTTCTGCCCCCGAGGATGCACTCTCCGCATCCTA TCTAGGCTTACAGCAATAGACTCTATTACCAGTTCACAAGATCTCTTTGCTTAGAAATCATTCATTAACATTTTNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAAAA TAAATTACTGAGAATAATTTAAATACCTTGGAACTATTTAAACTCACACGTGTCAGAAACATTTATTAATTAAACTCAAT TAATAATCCAGATTAGGCACACTAATAATCTCAATTACCCTAATTAATCTTAATTAATTCTTCAGGGTGTTACATCGACT CCAAGAATTTTG