>DTA_34_1_Mno length=2573;Class=DNA transposons;Order=TIR;superfamily=hAT; AGTTAGTGGTATTTTATAACTAATCGATTGAGCAGCAGCTTGTAGACCACTTAAAAAGAATATTTATTATTTCAACCGTA TCTTGACATAAGAATGCCAATGGGAGCAATACTTGAAATGGCAAAGCCATTAAAAAAAATACTGATATTGAGATCCACTA AAACAAGGTGAATCACAATTCAAATATTTTTGTTGTAGTTTTTTTTTTTTCTCACAAAAATTTGAATTTTTGTTTAAACT TTTTGTTCAAACTTATGACCAAATGTGCAATATTATGCGATAATGATGTTCGAGATTTTAAAGATTCATCCTGTCAATTC ATTTGATAATTGTATTCTGTGGCTTAGTGATTCTTGTATTTTCTTACTTGATTTCATATGAATGTACAGCATTCGGTTAA TTTCAAGCCTATGTGATGGAAATACCGAATGATTCGGGTATTAAGAAACCAAAAAGGTTGACCTCTGTCGTGTGGAATCA TTTTGAAAGGGTCAGAAAGGCTGACACTTGTTATGCTGTTTGTGTCCATTGTAACAAGAAGCTCAGCGGGTCGAGTAATA GCGGCACGACACACCTGAGAAATCACTTGATCCGGTGCCTGAAAAGATCTAATTTTGATGTGTCCCAACTACTTGCAGCA AAAAGGAGAAAAAAGGATACCACTATTAGCCTTACAAATATCGGTTACGACGAAGCCCAGAGAAAAGATGAGTCTATTAA ACCTTCAATGGTAAAGTTTGAGCATGATCAGAAAAAAGAAGAGATACTCAACTTTGGTAGTAGCAAATTTGACCGGGAAT GTAGTCGATCTGATCTCGCCCGTATGATTATATTACATGGTTATCCACTTGCCATGGTTGATCATGTTGGATTCCAAGTT TTTGTCAAGAATCTTCAGCCAATGTTTGAGGTTGTCCCGAGTAGTGATGTTCAGTATTCCTGTCTGGAAATTTATGGGAA AGAGAGAGAAAAGGTGTTTGAGCTGATGAATAGATTTCATGGGGGAATTAACCTTTCTGTGGAAACGTGGTCTTCTCAAG AAAATGTCGAGTATTTGTGTTTGACCGCACATTATATTGACGAAGAGTGGAGACTACAGAAGAAGATAATGAATTTTGTT ACGCTTGATTCTTCTCATACAGAAGACTTGCTCTCAGAGGTCATTATTAAGTGTCTAATGGATTGGGATATCGATAGTAA GCTGTCCGCTTTGACATTTGATGATTGTTCCACTGATGATGACATTGTTCTGAAGATTAAAGATCGGATCTCTGAGAACA GGCCTCTCTTGGGTCGTCAATTATTTGACGTGCGCTCTGCTGCACATGTTCTGAATTCAATCGTGCAAGATGCCATCGAA GCGCTACAAGAGGTGATTCAAAAGATTCGAGAAAGTCTCAGGTACGTAAAAAGTTCACAAGTAACGCAAGGGAAGTTTAA TGAAATTGCACAAGAAGTTGGAATCAACAGTCAGAAGAAATTAGTTCTTGATTATCCTATTCAATGGAACTCAACATACC TCATGCTCAAAACAGCCTTAGAGTACAGGGCCGCATTTTCTCTCTTGCAAGAGCATGACCCTGCATACATGTCTTCCTTA ACCGACGTGGAATGGGACTGGGTCACTTCCATCACTGGTTATTTGAAACTCTTTGTTGAAATCACTAATGTCATTTCGGG CAACAAATGTCCAACTGCAAACGTATTTTTCCCTGAAATTTGCGATATTCATATCCAATTAATTGAATGGTGCAAGAGCG CAGATGATTTTCTTAGTTCTACATCACTAAAAATGAAAGCCAAGTTTGAGAAGTATTGGAGCAAATGCAGTTTGGCTTTG GCAATGGCAGCAATTTTGGATCCTCGGTTTAAGATGAAGATTGTGGAATATTACTATTCTCAAATCTATGGCAGTAATGC TCTGGATCGGATCAAGGAAGTTTCTGACGGCATCAAGGAACTTTACAACATGTATTCGATTGTTCCAACTATGGTAGATG AAGGGTCAGCTTTACCTGGCTGTAGCATGACTAGTAGTAATGAGACTGGGGACAAACTCAAGGGCTTTGACAAGTTCCTC CGTGAAGCTTCTGAGAGTCAAAGTTCAATATCCGACTTGGATAAATATTTAGAGGAACCAGTCTTTCCTCGTAATGGTGA ATTCAAAGTGCTAAACTGGTGGAAGGTCCACACCCCAAGATACCCTATATTGTCTATGATGGCACGCGATATTTTGGCAA CTCCAATGTCCACAATTTCACCAGAATTAGCATTCAGCACAAGGGGCCGAGTGCTTGATCAATCTCAAAGTTCATTGAGC CCGGATACTCGGGAGGCTTTGATTTGCACACAAGATTGGTTGCGGGTGGAACCACTTGGTACTTGAGCTATTTCTCTATT TAACATCGCCTTAAATTTCTTGCACGTTGTACTTTATCTTATTCTAATTGATTTTATGCCATCAGATATCAATCCCCTCG CGATCCATACAGCTCGACCGCTTCTTATCGAATCAAGTTAATCACTCCTTGGTATGGTTGTTCTTTCTAAAAGATTCTCA TGTTGCCTACATT