>DTA_33_1_Mno length=2516;Class=DNA transposons;Order=TIR;superfamily=hAT; GTTAGGATTGAACTATTGTTATTGTTTTGTATCTTAGATATTGCGTATTGGTTTTCAATACAAAAAATGATGCTTTATGG TTTCAAACCTTAAAGAATCTATTTTTGTGAGTCCCTGGTAATTTTTTTCTGTTTTTATTCCTGGTGTAGATACAAACAAA CAAACAAATAACAAGCCTTAATCCCAACTAATTGGGGTCGGCTATATGGATTTCACTTTTCCACACTGAGTGAAATCCAT GAGAGTGACTTGCTTTTATTCCTGGTGTAGATATGGAACCAAAATCTATGATGGACATGGCAGTCATTCCGATTGATCAG GTAGATATTGGATTGGGTTCTTCAGAGAAGCCGAACGTTGTAAGTTCAGTAAAACCAAGAAAAAAGACGATGACATCAGT CTATCTTAAGTTCTTTGAGACTGCTCCTGATGGAAAAAGTCGCCGCTGCAAATTTTGCGGACAGAGTTATTCTATTGCTA CTGCAACTGGTAACCTCTCTGCCTATGGTCTATCATTTATATTGATCATACCACTCGCAATAACTTGAAAATTCTAAGCT TGTGGTGAACGAAAGTCGGTCCCATGTTGTCTAGCTACAGATCTAGTCTTTCATCTGTCATACAGCATATTCACTAATCT TCTCTATGTGAAGGTAACTTGGGAAGACACCTTAGTAATCGACATCCAGGCTATGATAAGTCAGGGGACACTGTCACTAA TTCCACGCCACAGCCTGTAGCAGTAACTGTTGCCAAGAAACCTCAGTCACAAGCGAAAACATCTCAAGTGGATTATGATC ATTTGAATTGGTTGCTCGTTAAGTGGCTTATTGTAGCAGCTTTGCCTCCTTCGACATTGGAAGAAAGATGGCTAGCAAAC TCCTATAAGTTCTTGAATCCATTGATTCAACTTTGGCCAGGTGACAAGTATAAAGCAGTATTTCACGAAGTATTCAGGAG CATGCAGGAAGATATAAGGGCATCTTTGGTGCATGTTTCTTCTAGGATCTCCATCACACTTGATTTCTGGACTTCCTATG AACAGATATATTACATGAGTGTAACATGTCAGTGGATCGACGAAAATTGGTCGTTCCAAAAGGTGTTACTCGATATCTGT TACGTACCTTATCCTTGTGGGGGTGCTGAGATCTATCACTCCCTAGTAAAGATCCTTAAGATGTATAACATTGAGAATAG AGTCCTTTCTTGCACTCATGATAACAGTCAAAGTGCCATCCATGCCTGCCATAGTTTGAAAGAGGATTTGGATACTCAAA AATTGGGGTCCTTCTGTTATATTCCCTGTGCAGCTCGTTCTTTGAATTTGATCATCGAGGATGGGTTAAGAACGATGAAA CCAATAATCTCTAAGATTCGGGAGTTTGTACTGGGGTTAAATGCATCCCCAGAAATCTCTGAGGATTTTATTCAATTAGC AGCAGCTTGTCAAGAAGGTAGTTGGAAGTTTCCACTCGATGCTTCAGCACGATGGAGTGGCAACTATCAGATGCTTGATA TTGTCAAAAAGGTACTTGCTGTCGGGCTCTAAGCACTCTGCTTTGAAATATGCATGTTATACAAGCTTGCTTATATGTGC ACTATGCATCATTTGACTAAAACACTAGTTTGATATGTACATTACAATAATATCCTCTTTCCTATTGATGTTTTTTACTG TTGCATGAAAATCGACATCTGGTACACTGCACCCTCGTGAACTCACCCGAATGGCCGAATCCAATAAAATACTAGTATTG CCTCTTGTTGTCAATCATGCAATTTGTGATATCTATAGCTTACGTATGCATCTTGATTAGTTTTTAATGCATCCAATATT GAATGTAACATACAGTTCGTTTGCATTACTATTATCTTTTAGGGCGTCTCAAATGACGAAGCTTTGTGTATTACATTATC TTAATAATTGTTCTACTACTTAGGCTTTGAATTTACCGAGTCTGACTAAATATGGCCTAGGATTTTATTTAGGCCAGCAA GTCTATGGATGCTGTTATCAGGAAGTATGAGGAGACGCTAGGCAGTAGGATGTTACTGAGCTCTGCTGAAAAAAACGCAA TCAGTGTTGTCCATGAATATCTGGAACCCTTCTACAAAACCACAAACAATATCTGCACAAACAAGGTGCCCACCATTGGG TTGGTTCTCTTCTTCATGGATCACATCTCCGAGATGATTGCTGCCTGCAGAGAAGCTCGTCATTATCCAGACTGGCTGAA GAATGCTGCCGAAGACATGGCCAAAAAGGCCAGGAGTTATAATAACCAGGTCTGCAACATATTCACTTACATGACTGCAA TTCTGGATCCTCGAATCAAAGGAGAACTAATTCCCGAGAACCTCAGCAATGAGAATTTTCTCGAGGAAGCACGATCCCAT TTCATAAGAAATTATTCGACTAGCCATTTCCCATCTATGACTAGTGGATATGGCACTCAAGATATTGAAGATGGGGGTAG TGTCTCGTTCGCAGAGGAAATTGCACGAAAGAAACG