>DTA_32_1_Mno length=2519;Class=DNA transposons;Order=TIR;superfamily=hAT; TTTTTCTTTCTTTTTTTTTTTTTTCTTTTTTTAATGCAATTTGGTACAATTCTTTCTGCGCACCCTTATTCTTTTTTTTT TTTTTTTTTTTTATGCAATTTGGTAAAATTTTTTTGGGCCACCCTTTTTTTTTTTTTTTTTTTTTTAAAGAAATTTGGGA AAATTTTTTTTGCCCACCCTTTTTTTTTTTTTTTTTTTTTTGGTTATTTTAATGATAAGTTTAGCTTTGCCAAAAATGGC GTCTGGTTTGGAACCCATACCTATAACGTCCCAAAAACATGACCCAGCTTGGAAACATTGCCAAATGTTCAAGAATGGGG AAAGGGTCCAGCTCAAATGTATTTACTGTAGCAAATTGTTTAAGGGTGGTGGGATTCATAGGATTAAGGAACACCTTGCT GGACACAAGGGCAATGCCTCGACTTGTCTTCGGGTCCCGCCCGATGTTCGGGCCTTGATGCAGCAGAGTCTTGATGGGGT TGTGGTGAAGAAGAGGAATAGGCAGAAGCTTGATGAAGAGATCACCAACATTAACCACAGGCCTCATAGTGAGGTGGATT CACTAGCCCATCAGGATGACGTTAGTGCTGGGATCAATTTGATCGTTGTTCATGATCACGCACTCGAACCCAATTCGAGC TTGGTGATGAACCGAGAAGATGGGGCGACGAGTAGTAGGAGTTTGGATAGAAGGAAGAGAGGGAGGGGTAGGAGTTCTTC AGCTCGTGATGCTATTAATGTATCTAATACTGTCGATTTAGGAACTAAGAAGGTAAATAATTTTGTGAACATGGCAATTG CGCGGTTTTTGTACGACATTGGGGCGCCTTTGGACGCAGTGAACTCTGCTTATTTCCGGCCGATGATTGATGCGATTGCT TCAGGTGGTTCGGGGGTTGTGTTGCCCTCGTATCATGATCTTCGCGGTTGGATGTTGAAGAATTCGGTGGAAGAACTGAG GAATGATGTCGATAAATGCAGAGCTACATGGGAAAAGACTGGTTGTTCTGTCTTGGTTGATGAGTGGAACACAGAAGTTG GCAGAGTTTTCCTGAGTTTTTATGTGCATTGTCCCGAAGGAACAGTGTTTTTGAGAAAAGTGGATGCATCTGACATCGTT AGTTCATCTGATGCTCTTTATGAGCTCCTTAAAAGAATTGTGGAAGAAGTCGGGGCAAAACATGTGCTGCAAGTGATTAC CAGAAGTAGCAAAGAGCAATATGCTGTTGTAGGGAGAAGGTTGAGTGAAACTTTCACTAGTTTGTATTGGGCTCCGTGTG CGGTTCATTCAATAGATTTGGTACTAGAGGATTTCAGTAATATAGATTGGATAAGTGAGGTGATTGAACAGGCAAGGACT ATTACAAGATTTGTCTACAATCACAGTGAGGTCTTGAATATAGTCAGAAGATACACTTTTGGCAACGATATTGTAGAACC GGGTGTCACCTGGTTCGCTACAAACTTCATGACATTAAAACGACTAGTTGACCTTAAACACAATTTGCAGGCCATGGTCG CCTCGCAGGAGTGGGTGGATTGCCCGTATTCGAAGAAACCAGGGGGGTTGGAAATGTTAGATTCCATTAGTAATCACTCA TTTTGGTCCTCATGCACCCTTGTTACCCATCTAACAAGTTCTCTCTTGCGAGTTTTGAGAATTGTTAGTGCTGAGAAGAG GCCTGCCATGGGATACATTTATGCAGCCATGTATCGGGCGAAAGAAACGATTAAGAAAGAACTTGTTAAGAAGGAGGATT ACGCAGTTTATTGGGATATTATAGATCACCAATGGGAACAACACCGAAACCTTCCTCTTCATGCAGCAGGGTTCTACCTT AACCCCAAATATTTTTACAGTGTTGAAGGAGATCTGCACAATGATATCCTCTCAGGGATGTTTGATTGCATAGAGAGATT GGTTCCTGATACGGATGTCCAAGATAAAATAATTAAGGAAATCAACTCATATAAGAATGCTGCTGGAGATTTTGGGAGGA AGATGGCAATCAGAACTAGGGACACTCTGCTACCTGGTAAGGATTTATTTCCTTTTTCCAGTTTCTTGGTTCGAAATTTT CTTACACTTTTGCAGAATACTTGGGGAGTTGCAGTTAGCATCTAATAATGATCTAGAGAACTTTTAGGTCATTTTAAGCT CTAGTTGACTATGAGTAAGGTTTAGATACCAGCTTTTGGATTTTTCATAATTCTTGTTAAAAATATATTCATCTTTACAT CAAATGACAGAGCTACTGTAAACATTATTTCCTAGATCACTAAACGAATGTATTAAGTTATCTCACGGCTAACATTTTCG AACTATTTTTGTCCTAGCCGAATGGTGGTCAACGTATGGAGGAGGTTGCCCAAACTTGGCGCGTTTGGCTACCCGCATTC TCAGTCAAACTTGTAGCTTGATCGGTTGTAAGCGGAATGAAGTTTGTGTTCAGAAAATACACGATACAGGGAACTCCATA GAGCAGCAACGTCTCAGCAACCTCGTCTTTGTTCAGCAC