>DTA_30_1_Mno length=3071;Class=DNA transposons;Order=TIR;superfamily=hAT; TAGAGGTGTGGGCAGGCAATTTAAGGGCGGTCCAGCCCAACTCGTAATAGTGTCAGGTTTAATACGGTATTATTATGAGC TGCGTCGGCTTGGCACATTTGATGGATTAGGATTGGGCTACGGTTTCTCAGCTTATGGCCTAGGCCTAACCTTAGCCCTT GAGGTTGGTGGCCTGGCCCAAGTTCAGTTCGACCTAAGCCCGGATTCAGAATTTGTTCAGCCCGGCCTACACACGATTCG TCCCACCAGAAGCCCGCTAGCTTGTGTCTGTTTGGCACACGAAGGACCCAACGGTCACAAGTTGAGAAATGCACCTAAAT TTCATCAATAAATACTCTTAAATCTCACACAACAATTCACTCTCAACTTCTCATCTCACCTCATTCTATTTCTCATCTTG TCTCTTTGATATTGATTTTAAGATTTTCTCTATCGATTACTCATTTTCTTGCTTTTTCATTTATAAATCTCGAAAAAAAT ATATTCTACTTATCAATTTTGTTACATAACATTATATTACTCAAGTTTATTTGTATTGTTTATTGTTTATAAATGAACGA ATAAACATTAGTTTCTTTTTTTTTTTTTTCAAAAAATGGCCGCATAAAATTTCTTTCATTTCACTGCTCTCCCTGAGCTT GGTGATGAGCCATTTTACGAGGATGAAATGTTGGCCCACAACACCACCCCCACTGAATCGAAAATTGCTTCGGTTGATAA TGCTTTAGTGCACAACGAGGAAGTTGGGGAACGTAGCAGGGGAAAAAGACTGTGAACTTCTCCCGCATGGCAACATTTCA CAGATGAGCCATGACCAAATCCAAAAACATGTGAAATGAAAATTCGTGTTGTATATAAATATTGTAAAAAGTATTTTTCT AATAAAAAGGATAGGGGTATTAGTCATCTGGATAGACATTGGAAAGCATGCCTACCCTTGCACCAAGGTGGGAGTGTGGA GTCCCACCATCAAACACTATCACTCACATCACAAGGGTTGCAAAGTTTTACCTACGATGCACAACGTGCTCATGAGGCAC TAGCTAAATTTTTAGCTAGTGCCGAATTACCTCTTTCTTTTGCAGATGATGCAGCATTTGAAGAATTCGTACAAATAGCC TTTTGCCCACAATTTAAACGGGTAAATAAAAACACAACTCGTTCTGATTGCATGAAAGTGTTTTATGCAATGAGACAATC TCTAGTTGATAATTTGAGGTCTTTTAATGCTACTATATCTTGTACTTCTGATCTATGGGAGGAGTACAATAAAACTGGAT ATTTATACGTCACGGCGCATTATGTTGACAATAAATAGGTTTTACAAAAGAGAATAATAGGTTTTCATTTATGTCCATTT TCTCATAACACATAGTAATGAAAATTTTTGGGTTTTATGAGATAGAAGATAAAGTTTTAATTATTATTTTTAATAATGCG TCAGCTAACACGGCTGCAATTAACATGTTTAAATGTAGTTTGAAACCGGCATTTAGTGGCAAAATTTTTCATCAACAGTG TGTATGTCATATAATAAATTTAGTAGTGCAAGCAAAAATTGAACATATTTCCTCTAATATAACAAATATTAGAGAATCTT AATCCTTCATATCTAGTTCTGGAGCTCGGCTCCAAGAATTCTGATAATATTGCAGGAATAGCCATATGCGCCCAAGAAAG TTTCCAACTGATATGAGACATAGGTGGAATTCCACCTACTTAATGTTGAAGGCTGCACTTCTGTATCAACAGCTCATCAC AACATATGTGAACAGTAAGAATGATAAAATTTTAATTCTTGATACAGATTGGAAGACTGGTGAGTACTTTTTAAAATTTT TAGAAGTTTTCTACAATGCTATTGAATTACTTTCTAGAGTTTATTATCATACTGCATATTTTAGCTTTGCACCAACTATT TAATATTTCAAAAATATTTTCTTATTATAGGGATACTGAACTTTTTAGAACTATAGTTAAGCTAATGGAAGCTATATTTA AAAGTTATTGGACCGGTTGTCTAATGTTATATGCATTAACAACCATTTTAGATCCTAAATGCGGAGTAGATGGGACCGAA TCTTTAATGACTGTCACGGCATAAAATTTAGGTATTGATATGTTACTAACTATTACTGATGCTAGGAAAATGTTAGAAAA ATTATTTGGTTTGTATGAAGCAAAATACGGAACAGGTAAAAAAGAATAGGGAACATCGACGTCAGTAAGCAGTTCGGGGC CTAAAGCCTCATCGTGGAGCTTCTTAAAGAAGAAAGATAAAATGTCAGGATAGTCATCAACACAAGCGTCTACCGAACTG GTAAAATATTTTGAATCGAATTTTATAATCGATGACGACAAACTGGACATCTACAGTGGTGGAGGAGCAAGACCGATCAT TTTTTTAATACTGTCCGTAATAGACCATGACATTCTGACAACTCCAATGCCAACGATAGCATCGGAGCAAGCATTTAGGG CAAGCAACCGAATTCTTGACGATAAGAGATGCAGAATGTATCTGGATATCTTGGAGGGTGTTAAAGATTGAGAAGATGCA AGAAGACGAAAACAAGAATATACAGATGATTCAATTTAATAATATTTTTCTAACTAAGACATAACAAAATCTTCTGGAAG CACTTAGATTTTGTAATTTACTTATCCTTGAATACTGCATTCTTTTTTCCTTTGCTAAGGTTTTGTCCCGATCTCCCCAC GGGTTTTACTTGGCAAGGTTTTTAACGAGGCGGTCATTTAGGTGTACTTATTCGTATTATCTCAATTCAATAAAATCACA TCTTTTGGGGGCATAAGATATATTTTCTTTTTTTAATTAAATATTATAAAAAAAATAAAAGAGCCAGAGTCAGCCCGTGA AGGGCCTGGGCCCGGCCCTGACCCTTATGGACTAGGGCCGAGGGCCAGTGCTGGGTCTTACGGTTTCTCCTCAGGCCGGG CCCTACACGGCTCTGCACTGTGCTGGGCCGTGCCAAGCACGGCCCAGGCCCACCACAGACCTAGGGTTAGAAGGGCCGTG CCGGCCCGGCACGGTCCTTTTGACATCTCTA