>DTA_3_1_Mno length=6680;Class=DNA transposons;Order=TIR;superfamily=hAT; CAAGGTTTTGAAAAGCGCCCGAGGCGCACGCCTTGAGGCGCACGCCTTGAGGCGCGCCTCATGGCCAGGCGCTCGAAAAG CGCCTCAACTCCTACGCCTTACAGGGTAGGACTTGAGGCGTGCGCCTCAGCCACTTGAGGCGCACGCCTTCGAGCGGCGC CTTATGCGGTATTTGAGGTGCACGCCTCATTGAAATGGGTACTCTGGGGTCTTTTAAACCCAAAACATGCGGGCCCAACA TATTTAAAAAGCCTAAAGAAATCAGGCCCAAAATTAGTAAGAAAAAACCTTAAGAAAATAAGCAGACTAGCCAGCTCACT GTTCCCCTTCTTCTTCGCACCTCACCTCTCATGTTCATTTGTTGCTCTGCTGCATCCACTGGAAGTCCAGCCGTGGCCTG CGGAAGAAAAGAGATCAAGCCGACCCTTCAAGTGAGGTATCTCTTCTCCTTCTCCTTCTTCTTCTTCTTCTTCGCACCTA TTCACCTATTCTTCACGTTTCTCTTGATGCACGTGCACCGTGAACTTGAGTCCATGACAAAAGGACTTTTTTTGTTTAAG TTAGGACTTAGGATGAGACAACAGGTGAACCATTTTTTGGGTTTAATGTGTTTTTTTTTTTTATTTAACAACAGTGAACC GTGAACTGTGAAGAATAGCTTTTTTTTTTTTTTTTGTTTAACAACAATGAACCGTGAAGAATAGGTTTTTTTTTTTTTTT TGGTTTTGGGTTTGACGTGTGGTTTTTTTTTTTTTTTTTTGGTTTAAGTTAGGATGTGACCTCCACAAAATGGCAATGGT AGTGGTAGTGGGAAAATGGACCCGGCTTGGAAATATGGAAAAGAAATTACAAACGAAAATGACAAAAGGACTTATATTTA CCTCCAATGTGTGTTTTACAATCAAATTATTAGAGGTGCTAAGAAAATGAAAGACCACCTTGGTTGCACTCGTAAGAATG TAAAGCATTGTCCTAAGGTTCCTGATGATGTGAAGAAAGAAATTAATGACTATATGAACAAGTGGGTTGCTAAAAAACAG TCAGCGCATAAATGTTTTGAAGAAATGGTGGATATTGGCTCTTATTTTAGTGATAGATTTATCGACTCTTGTCAACCGCT GCAAGTGGTTAGTTATAGAGGAGTTAGAGATCCCATGGATAGGTTTTTGAACAATGTGGATGATAAGGAAGCAAACGAAA AGCCTTCCCTTAGAACGACATCAAGTGAGAAAGAGGCACGTTCTCGAGTATGTCTCGATATTGGTAGGTTCTTTTATGAA AATGCACTTGCTTTCAATATTGTTAGGAGCCCCCCTATTTTAATGTGTAGATCAATTGGCAACTATGGTAGAGGTGTTGT ACCCCCAAATATACATGAGCTTAGAACATGGATTTTGAAGGAGAGTACTTACTACTGAAAAATTTGTGGAGGAGGTTAAA ATGACTTGGAAACAAACAGGAGTTTTTATTTTATCTGATGGCTGGTTGGATGCTAGAAATCGAGGTTTGATCAATTTTTT AGTCAACAATCCTCATGGAACTATTTTTTTGAGATCTGTTGATTCCTCTGATAAAAAAAAAGATGCAAATCTATTGTTTG AGATGCTTGACGAGATTGTTGAATAAGTTGGGGAAGATCTTGTTGTTTAAGTTGTGACTGACACTGCAAGTGCTTATAAG GTTGCTGGAGCAAAACTAATAAAGAAAAGAAAACACTTATTTTGGACTCCATGTGCTGCTCATTGTATTAATTTGAGCTC TAAGAAACTAGGAGAATTGCCACAATATAAAAGGGCTTTGGTGAAAGCGAAAAAAATTAGCAATTATGTGTATAATCACC CTTGGGTGTTGTCATTGACGAGAAAGTACACCAAAAGGGATCTTGTTTGACCTGCTGCAACAAGACTTGCCACTGCCTAT CTGGCTTTGGAGTGCATCTATAGATTAATGTAGCCTCTACAATCTATGTTTGTATCGGAGGAATGGAACAATAGTTCGTA TGCAAAAAAACTGGATGGGAAAGAAGTGAAAAAGAGAGTCATGAAGGATAATAAGTTTTGGGCTGTTGTTGGGTATGTTC TTAAGTCTACACAACCCATAGTGAAGGTGTTGAGAACTCTGAAAAGACGCCCGCCATGGGATTTATATATGGGGCTGTGG ACAAGGCAAAAGATGAAGTTACTAAAAACTTGAGAGGTGAAGAGAAAGACTACAAGGAGATTTGGGAGATCATTGATGAA AAGTGAGATTTTCAGTTACATCAACATTTACATGCCACGGCATACTACTTGAATCTAAGGATTCGATACTCCGCTAATCC TTCCAACCATCCTGAGATCAAGCTTGGTTTGTACCATTGCATGAATAGGATGTTTAAGGACCCAAATGCTCTAGAGAAGG CCGACCTCCAACTAGATGAATTTCGAAAGAACAAAGGGTTTTTTTGCCTTCGTCAAGCTCAAGCATCATACATGAAACGC AATCCTAGTAAGTAGAAACTATCTGTTAGGTACCTAGGTTTTTCACAGCCAAACATACACATTAATCCTGAAATTGACAA GGAATTGGATAGAAATAAGGGAATTCTTTTATTGAAAACCACTAGCCAATCTCCAATTACATTACTAAACACTACTAAAC GGAAATGTAAAGGATAGAACGGAGAATTCAAGTACTCCGAGACTCCTAATTTAGTGGTATTCGAGAGACCACCCATCTCC CTAATCTCAATCTCCAAAAACTCTCAAAATCACAACCTCTCCTAGTGAGCTACTAAGCCCTTTATTTATACTAATTCCTA CTAACTCTACCCACCCACTAACCAAACAAAAGTCATTAACCCCGCCCCAAAGAAACACCTTATCCTCAAGGTGTTAAGTA ATCGCAGCCGTGTGACTCCACTTCCAATCTTGATGAGCTTGGATCTTGGAATGTCGAACGAAATGATTCGTACAGAACTT GCTTCAAATGTTCTTGTTAACTTTATTTTTTCAACTTCACACTTTTGTTTGGAGTTGAAATTGAGAACCATTTTAAAGGC AGCGAAACCATGAAGCTCAACCTCAATATCGTCCTTGTAGTAATGGAAGACCTTGTTGGTCAGCTCAAACAATTCATTTA TAACAAAAACCTTCCTCCCATAAGCGTTATCTTACTGCAGTGCATGTTCCACCATGCCAGAGAAAGCTGCCTTGTTGTTT GTCAGAACATCAACAATGGAGGGCAGTTGCAAGTGTACACTCTCCATTCCTTTGTCAACAGCCCCAGAATTGCTGCAAAC AGAATCAAATTCATCTGTTAAAATACAAGAATGGACTCCACTGTTAACTTCTTTCACGGGTGTAGCAAACTCTGACTCTA TAGTAACATCCTTGGAAAATTTTGATATCATTGACATCTTGTTTCCCATATCTCGAAGCCCCTCATTACTAGCACCAGAC TGAAAACCAACTTCATTTTCAATGCCTTGGTCCACCTTGCTATCAAAATTCTTCATAGTTAAGTCTTCTTGAACATCCAT TTGATATGGAACATCTGTTGTTTGAGTTGGAAGCAACCTGTTTGAACTGTCTACCACTTGCTCTTTATCGACTTCCAATT TTGTAATGACAACTCTCTAAAATTGAATTTGAAATCTCTTTCCCAAGTTTGGCAAGTACCTTGAATTGTCGTCTATAGTC AGCCATAATATCCTCTTGACGTTTCACCACGAAACTCTCATGTAGGGCCTCATCGGATGACAATCTGAAATGCTTAAGCA GATGAGTCTTCAATTCATTCCAACTGTAGAACGGGCAACGAGCATCCGGCCATCGATACGAAGCCAAAGCATCACCTTTC ATAGCCATTTCAGCAACATGGATTTTCTCATTGTTCGTCATTCTATAGAACAAAAAGTATCGTTCAGCTCTAAAGACCCA CCCATCAGGGTCTTCTCCAGCGAAAAATGGCATATCCATTCGCTGAAATTGTTGATCCGTTCGGCCCTCCTCCCATAGGG TGTCGTGCTACCCTTCCCTCTTCCTACTCGAAACCCTTGGATTGATTCTGACTCCAAATCGAGAAGACCCAACTCGCTCT CTCAAATCAGATTGTAAAACCCAATCTCCCTCACCCAACTCAGATCGCCCAGACCTAACCCCAATCATGCCAAAACTTGA AGATCTAGTCCATATTTGGTTGTAATTGGCTCTAATCTTGCTGTAAGTTCGAGGCCCAACCCAAACATCATCGGAATCAG TCTCAATCACATCAGAATCGCAAAACCCAGACCTAGGGCCGCCGAAATTTCGGAACCCATTCCTAATTTCGCCAGAATCC TCCCAAATCGGGCCGAACTCGTGTGACCCAGTCCGAATGCGGCCGGAATTAACCTCAGACGAACCAGAATTGCGAAGCCC GGTCCAAAACGGGCTGGAATCAGCCCCAACCGCGACCGAATCAGGCCTGGGTTCCCTATTCCGAGGGTACCCATGTCGTC CCAGCCCTAGAGCAAGCTTCTCCTCCTCTAACTCCGGCTCCCACTCTAGTTCTCGTTGCCGACCAAGCTCTGCCGCCCTC TCTCGACGGTCGCGACCTCCTTCCGCCTTCCTCCCGTCGTCGAACAAACCATCGCGCTGCAGATCCGGACCACCCTGCCC CAGATCGCGATGAATCTTGCGCTCCTCCATGAGACCCACATCTCTCCTGCGTCAGAACTCCCTCTTGCGGCCTCGATCTT CGCGAATCGGCACTTCCCGGCAAAGATCCGCCTGGGCCGACGCGATCTGGGCTCTCCTCGCCCTGAGGCGCGCGATCTCA CCTCTCCCTGTCCCGTCGTTCGCCATCGCGACCTAACTCGGCCTCCCCGGCCATCGGCCGCGCCGCCAGCAGTGCCTCCA TCCTCCGCAGTGCCGCCTGCACGTCTTTCATCTAAGTCCGAACCTCCCCCAGTTCACTACGCAGCCCAGCCACTTCACGG ATCTGCGGAAGATTCTCGGTCACCATCACGTGGACCACCTCCTGGACCACCGCCAATCCCTTTTCCACCGTAGTCACCCT CTCTGGATCCGCTAGTTTAGGTGCCATGGATCAGAGCTCTGATACCAAATTGTTAGGTACCTAGGTTTTTCACAGCGAAA CAGCCAAACATACACATATTAATCTTGAAATTGACAAGGAATTGGATAGAAATAAGGAAATTCTTTTATTGAAAACCACT GGCTAATCTCCAATTACACTACCAAACACTACTAAACGGAAATGTAAAGGATAGAACGGAGAATTTGGGTACTCCGGAGA CTCCTAATTTGGTGGTATTCGACAGACCACCGCTCTCCCGAATCTCAGTCTCCTAAAACTTCCAAAATCACAACCTCCCC TAGTGAGCTGCTAAGCCTTTTATTTATTCTAATTCTTACTAACTCTACCAGCCCACTAACCAAACAAGGTCCTAAGTCAT TAACGGATCCTAACATTGGAGTATTCGATGACTCCGGAGAACTCTTAACTTTTTAATGGTATTCGAGAGACCATCAACTC TCCCTAATCTCAGTCTCCAAAAACTCTCAAAATCACAACCTCTCCTAGTGAGCTACTAAGCCATTTATTTATACTAATTC CTACCAACTCTACCAGCCAACTAACAAAACAAGTTTCCAAGTCATTAACGGATCCTAACACTATCTTATTAATTTTGGCT AATAAAACAGTTTAGATTGTTTGGCTAATTATTTTCATCTCAATTTTAAATTCAGATGATTAGTGGTCCCAATTTGAAGA TGGTACCCCAGAGTTGGCTAGCTTTGCAGTTAGAATTTTGAGTCTCACTTGTTCATCTTCGGGATGTGAACGCAATTGGA GTACCCACAACCAAGAGAAGAAATCGCTTGACTGCACAAAAAATAAATTTCTTGGTCTACATCATGTTCAACAAGAAGCT AAAAGATCGACATTTGAGAAAAAAAACACTTCAGCCAGATAAGGATCCTTTAATCATAGATGAGTTGCCATCTGATGATG AATGGGTAGCTGAAAATGAAAATGAAGGCGAAATTCAAATGGAGGAAGCAATTGACAATCTTGACATTGATCTTTTTGAG AATGAAGAAGGTATGAGCACTAGTACTAGAGCTCGAAAAGGCTCTAAAAAGAAGACGACGGGCTAGTGGCTTGATATGCC TTATGAATTATTAGTTATCTTCCCTATTATTTACTCTAATTATCATATTAGAGATAGTGACTTATGTTTAATTTTGATTA TTAGGTGATAGAGACAAGGAGACCGTGCAAGAGGATGAAGAAGAAGAGTGGATAGACTGTGATTCTGACACTAACAATCA AGAATTCGTGGACAATGAGAGATTTAAATTGGTTGATGCTTATCTTAGCAGTGCTGATGATTGATGAGTTGGGAGATTTG GCTTTTAGAAGTACATTATGAACCTTATGAGTTATGATATTAGGATTTGATAATTATTTAGTCTTTTTTAAGCTTCTAGT AGTCAAATAGACTTCTCTTTATGTGTATGTTTGGTTAAATTTCTTATTTTTAATGATTATTAAGTTTGCATTTAGTTTTT GTTACTATTATTTTTTTTTAGGTATTTTTTTAGGCTTACGCCTCAGAGCGCCTTGAGGCTTACACTTCGCCTCGTAAAGG CAAAACGCCTCGAGGCCAAATTCTATCTTTTAAAAACTTG >DTA_3_2_Mno length=3409;Class=DNA transposons;Order=TIR;superfamily=hAT; CAAGGTTTTAAAAAGTGCTAGAGGCGCAGGCGCGCCTCGTGGCGAGGTGCTGGAAAAGCGCCTCAACTCTTACGCCTTAT AGGGTAGGTGTTGAGGCGCACACCTTTGAGCGGCGCCTCAGGCGGTTAGTGAGGCGTCTGCCTTAGTAATGTAGGGTTTC TGTGGGCTTTTTTAAGCCTAAATGAAGTGGGCCGCTGGCCCCAAAGGCCTAAATACCAGGGTAACAAAAACTGAACCAGA ACAACAACTTTCGCACCTCTCTGCCTCCTTCTTCTTCGCACCTCTCCCTCCTTGCAGTGCATCCTTCTTCTTCGCACCTC TCCCTCCTCCCAGTGCCTCCTTCTTCTTCGCACCTCTCCTCGCGGGTTCCTTTGCTCCATCAACCAGAACGGCAGAACCA GCTATTCTTCTTCTTTCCCGAAGCCGTGCCTTCATCTTCTTCTTTAGAAGGTTCTCACGGCTTCCTCTGCTCCAACCAGC CACGGCCGCACCATAGAGGACTTCATAGCAAGCCGACGGCCAACCTTTCAAGTGAGATATCAAATCCCTTCTCTTGACTT TTTTTTTCCCTTTCATTTTGTAGTAGCATTCTAGTAGATCAGTGGACCGTGAATCACTTTTTGGGTTTAATGTTGCATTT TTTTCCTTGGTTTAAGTTAGGAATTAGCCAATGAGACCTCCACAAAATGCTAGCGGTAGTCATAGTGGGAGATGGGATCC GGCTTGGAAATATGAAAAAGAAATTACGTAAGAAAATGACAAAAGGACTTATGTTTACCTCCAATGTGTGTTTTGCAATC AAATTATTAAAGGAGGTGTTAAGAGAATGAAAGAACACCTTGCTTGCACTCATAAGAATGTAAAGCTTTGTCCTAAGGTT CCTGATGATGTGAAGAAAGAAATTAATAACTATATGAACAAGTGGGCTATTGAAAAACAGTTAGCGCACTAGAAATTTAA AGAAATGGTGGATGTTGGCTCATATTATGGTGATGGATTTGTCGACTCTTGTCAATCGCCGGAAGTGGTTAGTGATAGAG GAGTTAGAGGTCCTATGGATAGGTTTTTGAACAATGTGGATGATAAGGAAGCAAACAAAAGACCTTCCCTTAGAACGACA TCAAGAGATAAAGAGGCCCGTTCTTGAGTATGTCTCGACATTGGTAGGTTCTTTTATGAAAATGCACTTGCTTTCAATAT TGCTAGGAGCCCTTTCTATTTTAATATGTGTAGATCAATAGGCGACTATGGTAGAGGTCTTGTACCCCCAAGTATGCATG AGCTTAGAACATGGATTTTGAAGGAGGAAGTACTTACCACTGAAAAATTTATGGAGGAGGTTAAAATGACTTGGAAACAA ACATGAGTTTCTATTTTATCTGATGGCTGGTCGGATGCTAGAAATCAAGGTTTGATCAACTTTTTAGTCAACAATCCTCA TGGAACTATTTTCTTGAGATATGTTGATGCCTCTGATAAAAAGAAAGATACAAATCTATTGTTTGAGATGCTTGACAAGA TTGTTGAAAAAGTTGGGGAAGATCTTGTTGTTCAAGTTGTGACTGACAATATAAGTGCTTATAAGGCTGCTGGAGCAAAA CTAATGGAGAAACGAAAAAACTTATTTTGGACTCCTTGTGCTGCTCATTGTATTGATTTGATCCTTGAGAAACTAGGAGA ATTGCCACAACATAAAAGGGCTTTGTGAAAGCAAAAAAAATTAGCAATTATGTGTATAATCACCCTTGGGTGTTGTCATT AATGAGAAAGTTTACCAAAAGGGATCTTGTTCGACCTGCTACAACAAGATTTGTTACTGCCTATCTGACTTTGGAGTGCA TCTATAGACTAATGCAGCCTCTACAATCTATGTTTGTATCGGAGGAATGGAACAATAGTTCATATGCAAAGAAACCGAAT GGGAAAGAAGTGAAAAAGATAGTCATGAAGGATAATCAGTTTTGGGCTGCTGTTGGGTATGTTCTTAAGCCTACACAACC CATAGTGAAGGTGTTGAGATTAGTCGACTCTGAAAAGATGTCCGCCATGAGATTTATATATGGGGCTATGGACAAGGCAA AAGAGAAAATTGCTAAAAACTTGGGAGGTGAAGAGAAAGACTATAAGGAGATTTGGGAGATCATTGATGAAAAATGGGAT TTTCAGTTGCATCAACATTTACGTGCCGCAGCATACTACTTGAATCCAAGGATTCGATACTCTGATAATCCTTCCAACCA TCCTGAGATGCTTGGTTTGTACCATTGCATGAATAGGATGGTTAAGGACCCAAATGATCTAGAGAAGGCCGACCTCCAAC TAGATGAATTTCAACACAAGAATGGGTTTTTTGGCCTTCGTCAAGCTCAAGCATCATACATGAAACACAATCCTAGTAAG TAGAAACTATCTTATTAATTTTGACTAATAAAACAATTTAGATTGTTTGACTAATTATTTTCATCTCAATTTTAAATTCA GATGATTGGTGATCCCAATTTGGAGATGGTACCCCAGAGTTGGCTAGCTTTGTAGTTAGAGTTTTGACTCTCACTTGTTC ATCTTCAGGATTTGAACGCAATTGGAGTACCTACAACCAAGTTCATACCAAGAGAAGAAATCGCTTGATTGCACAAAAGA TAAATTCCTTAGTCTACATCATGTTCAACAAGAAGCTAAAAGATTGACATTTGAAAAAAAAAGCACTTCAGCAAGATGAG GATCCCTTAATCATTGATGAGTTGCCATCTGATGATGAATGGATAGCTGGAAACGAAAATGAAGGCGAAATTCAAACAGA GAAAACAATTGACAATCTTGACATTGATCTTTTTGAGGATGGAGAAGGTACTAGTATTAGAGCTCAAAAAAGCTCTAAAA AGAAGAGGACAGGTTAGTGGCAAGATATGCCGTATGAATTATTAGTTGTCTTCTCTATTATTTACTCTAATTATCATATA AGAGATAGTAACTTAAGTTTAATTTTTATTATTAGGTGATAGAGGCAAGGAGATCGTACACGAGGATGAAGAAGAAGAGT GGATAAACTGTGATTATGACACTAACAGTCAAGAATTCGTGGACAATGAGAGATTTAAATTGGTTGATGCTTCTCTTAGT AGTGATGATGATTATTGATTAATGACTTCGGAGATTAGGCTTTTAGAAGTGCATTATGATCCTTATGATATTAGGATTTG ATAATTATTTAGTCTTTATGTGGATATTTGGTTAAATTTCTTGATTTTAATGATTATTAAGTATTGATTTTTTTTTGGTA CTATTATTTTTTTTCTCAATTTTTTTATAGGCAGTTTTTGAGGCTTACGCTTCAAAGCGCCTTGAGGCTCACGCCTCGCC TCGTATAGGCAAAACACCTCGAGGCCCGATTCTGCCTTTTAAAACCTTG >DTA_3_3_Mno length=3200;Class=DNA transposons;Order=TIR;superfamily=hAT; CAGTGTTTTAAAAAGCGCCTGAGGCGCACGCCTTGAGGCGCGCCTCGTGGCGAGGCGCTAGAAAAGCGCCTCCATTCCTA CGCCTTAGAGGGTAGGAGTTGAGGCGTGCGCCTCAACCGCTTGAGGCGCACGCCTTTGAGCGGTGCCTCAGGCGGTTAGT GAGGCACACGCCTTGCTTGTATAGGATTTTCAGTGGGTTTTTAACCCTAATTGAATTAGGCCGGCCAACCCCGAAAGCCC AAATACCAGAGACTGAAAACATAACCTCTCCCTCTGCGAAATCTTCTCATTCTTTCGCGCCTCTTCCGCCAACCGCCGTG CCTCGTTCTTCTTCGCAGCTCCTTCATCGCCGACCGCCGTGCCTCATTCTTCTTCGTAGCTCCTCCTACTCCTTCGCAAG GTTCCTTCTACTCAACCTTTTTTTTTGCATTTTGAAGGCTTACTCGATTATTTATATATTAAAGATTTTTATTCTTATGC ATTGATGTTCCTTATGTGTTTATGAGAGAAACAACTAAATGCTATATTGTTTGTTTTTCTCTTGTAATTCTGGTTTTTTT TTTTTGTTTAAGTTAGGAATTAGGATGAGACCTCCACAAAATGCTAGCGGTAGTCGTAGTGGGAGACGGGATCCGGCTTG AAAATATGGAAAAGAAATTACATCAGAAAATGAGGACTATGTTTACCTCCAATGTGTGTTTTGCAATCAAATTATTAAAG GAGGTGTTAAGAGGATGAAAGAACACCTTGCTTGCACTCATAAGAATGTAAAGCCTTGTCCTAAGGTTCCTGATGATGTG AACAAAGAAATTAATGACTATATGAACAAGTGGGCTGTTGAAAAACAGTTAGCGCATCAAAAATTTGAAGAAATGGTGGA TGTTGACTCTTATTATGGTGATGGATTTGTCGACTCTTGTCAATCGCCGCAAGTGGTTAGTGATAGAGGAGTTAGAGGTC CCATGGACAGGTTTTTGAACAATGTGGATGATAAAGAAGCAAACGAAAGACCTTCCCTTAGAACGACATCAAGAGATAAA GATGCCCGTTCTCGAGTATATCTCAACATTGGTAGGTTCTTTTATGAAAATGCACTTGCTTTCAATATTGCTAGGAGCCC CTCCTATTTTAATATGTGTAGAACATGGATTTTGAAGGAGGTTAAAATGACTTGGAAACAAACAGGAGTTTTTATTTTAT TTGATGGCTAGTCGGATGCTAGAAATCGAGGTTTGATCAACTTTTTAGTCAACAATCCTCATGGAACTATTTTCTTGAGA TTTGTTGATGCCTCTGATAAAAAGAAAGATGCAAATCTATTGTTTAAGATGCTTGACGAGATTGTTGAAGAAGTTGGGGA AGATCTTGTTGTTCAAGTTGTGACTGACAATGCAAGTGCTTATAAGGCTGCTGGAGCAAAACTAATGGAGAAACGAAAAC ACTTATTTTGGACTCCTTGTGCTGATCATTGCATTGATTTGATCCTTGAGAAACTAGGAGAATTGCCACAACATAAAAGG GCTTTGGTGAAAGTAAAAAAAATTAGCAATTATGTGTACAATCACCGTTGGGTGTTGTCATTGATGAGAAAGTTTACCAA AATGGATCTTGTTCGACTTGCTGCAACAAGATTTGCTACTGCCTATTTGACTTTGGAGTGCAGATATAGACTAATACAGC CTCTACAATCTATGTTTGTATCGGAGGAATAGAACAGTAGTTCATATGTAAAGAAACCGGATGGGAAAGAGGTGAAAAAG ATAGTCATATAGGATAATCAGTTTTGGGCTGCTGTTGGGTATGTTCTTAAGTCTACACAACCCATAGTGAAGGTGTTGAG AGTAGTCGACTCTGAAAAGATACCCGCCATGGGATTTATATATGGGGCTATGGACAAGGCAAAAGAGGAAATTGCTAAAA ACTTGGGAGGTAAAGAGAAAGACTACAAGGGAGATTTGGGAGATCATTGACAAAAAGTGGGATTTTCAGTTGCATCAACA TTTACATGCCGCGGCATACTACTTGAATCCAAGTATTCGATACTCTGATAATCCTTCCAACCATCCTGAGATCAAGCTTG GTTTGTACCATTGCATGAATAGGATGTTTAAGGACTCAAATGATCTAGAGAAGGCCGACCTCCAACTAGATGAATTTCAA CAAGATGAATTTCAACAGAAGAATGGGTTTTTTGGCCTTCGTCAAGCTCAAGGATCATACATGAAATGCAATCCTAGTAA GTAGAAACTATCTTATTAATTTTGACTAATAAAACAATTTAGATTGTTTGACTAATTATTTTCATATCAATTTTAAATTC AGATGATTGGTGGTCCCAATTTGGAGATAGTACCCCAGAGTTGGCTAGCTTTGCAGTTAGAGTTTTGAGTCTCACTTGTT CATCTTCGGGATGTGAACGCAATTGGAGTACCCACAACCAAGTTCATACCAAGAGAAGAAATCGCTTGACTACACAAAAG ATAAATTCCTTGGTCTACATCATGTTCAACAAGAAGCTAAAAGATCAACATTTGAAAAAAAAGGCACTTCAGCAAGATGA GGATCCCTTAATCATTGATGAGTTGCCAAGCGAAATTCCAACAGAAGAAGCAATTGACAATCTTGACATTGATCTTTTTG AGGATGGAGAAGGTACTAGTACTAGTACTAGAGCTCAAAAAAGCTCTAAAAAGAAGAGGACAAGTTTGTGGCAAGATATG CCGTATGAATTATTAGTTGTCTTCTCTATTATTTACTCTAATTATCATATAAGAGATAGTAACTTAAGTTTAATTTTTAT AATTAGGTGATAGAGGCAAGGAGATCATGCAAGAGGATGAAGAAGAAGAGTGGATAGACTTGTGATTCTTACACTAACAG CCAAGAATTCATGGACAATGAGAGATTTAAATTGGCTGATGCTTCTCTTAGTAGTGATGATGATTATTGATTGATGACTT GGGAAATTAGGCTTTTAGAAGTGCATTATGATCCTTATGATATTATAATTTGATAATTATTTAGTCTTTATGTGGATATT TAATTAAATTTCATGATTTTAATGATTATTAAGTATGGATTTAGTTTTTGTTACTATTATTTTTTTTTTTCTAAATTTTT TATAGGCAGTTTTTGAGGCTTACACCTCGCCTCGTAAAGGCAAAACGCCTCGAGGCCCGATACCGCCTTTTAAAACCTTG >DTA_3_4_Mno length=2516;Class=DNA transposons;Order=TIR;superfamily=hAT; TGGCGTGGTTCTCTTCGTCAGAGTGCTCATCTGTCCTTTCTAGTTGCGGCCACCTGCTCTAAAAATGGGTGTACTCTTTA TTAGGGCATCCAAGGATGTTGAGGTGGCACCTAGTGAGTGATTGGGTCCAAATGACTCTGCACAACAACATCATCTTGTG TAATTTTATCTTTTCCCTTCGCTTTGACATGTGTTGATGTCACTCACAAGGCTGCTTGCTGTTAAATTTTGCTGCAGCAA AATGCTGCAACATTTCCTTCAAAATTCCTTCCATACACATCAACACACCTTAGAGCACAACTCAGCGTTTTTAATTCAAT TATCTTCAAATACACCTCATATTTAGCACATATCCTGACTTTAGCATGGCAGAGCGCAAGAATCAGAAATTGAAGATAAA ACACATGAAAACTAACAAATTTACCCTTGGTCAAACAAACTTTAAGCTAAGAAATGCCTAAGATAACTCTAATTTCTAGA GTTAGCACTTGCACTCATAAGAATGTAAAGCCTTGTCTTAAGGTTCTTGATGATGTGAAGAAAGAAATTAATGATTATAT GAACAAGTGGGCTGTTGAAAAACAGTTAGCGCATTAGAATTTTGAAGAAGTGGTGGATGTTGGCTCTTATTTTGTTAATG GATTTGTCGTCTCTTGTCAACCACCGCAAGTGGTTAGTGATAGAGGAGTTAGAGGTCCCATGGACAGGTTTTTGAACAAT ATGGATGATAAGGAAGCAAAGGAAAGACCTTCCCTTAGAACGACATCAAGTGAGAAAGAGGCCCATTCACAAGCATGTGT CGACATTGGTAGGTTCTTTTATGAAAATGCACTTGCTTTCAATATTACTAGGAGCCCTTCTTATTTTAATGTGTAGATCA ATTGGCAACTATGGTAGAGGTCTTGTACCCCCAAGTATGCATGAGCTTAGAACATGAATTTTGAAGGAAGAAGTACTTAC CACTGAAAAATTTGTGGAGGAGGTTAAAATGACTTGGAAACAAACAGGAGTATCTATTTTATTTGATGGCTGGTCAGATG CTAGAAATCGAGGTTTGATCAACTTTTTAGTCAACAATCCTCATGGAACTATTTTCTTGAGATATGTTGATGTCTCTAAT AAAAAGAAAGATGCAAATCTATTGTTTGAGATGCTTGACATGATTGTTGAAGAAGTTGGGGAAGATCTTGTTGTTCAAGT TGTGACTGACAACGCAAGTGCTTATAAGGCTGCCGGAGCAAAACTAATGGAGAAAAGAAAACACTTATTTTGGACTCTTT GTGCTGCTCATTACATTGATTTGATCCTTGAGAAACTAAGAGAATTGCCACAACATAAAAGGACTTTGGTGAAAGCGAAA AAAATGAGCAATTATGTGTATAATCACCCTTGGGTGTTGTCATTGATGAGAAAGTTCACCAAAAGGGATATTGTTCGATC TGCTGCAACAAGATTTGCTATTGCCTATCTGACTTTGGAGTGCATCTATAGACTAATGCAGCCTCTACAATCTATGTTTG TGTCGGAGGAATGAAACAATAGTTCAGATGCAAAGAAACCGGATGGGAGAGAAGTGAAAAAGATGGTCATGAAGGATAAT CAGTTTTAGGCTGTTGGGTATGTTCTTAAGTCTACAAAACTCATAGTGAAGGTGTTGAGATTAGTCGACTCTGAAAAGGT GCCCGCCATGGGATTTATATATGGGGCTATGGACAAGGCAAAAGAGGAAATTGCTAAAAACTTGGGTGATTTGGGAGATC ATTGATGAAAAGTGGGATTTTCAATCACATCAACATTTACATGCCGCAGCATACTACTTGAATCTAAGGATTCGATACTC TAATAATCCTTCCAACCATCATGAGATCAAGCATGGTTTGTACCATTGCATGAATAGGATGTTGAGATTAGTCGACTCTG AAAAGATGCCCGCCATGGGATTTATATATGGGGCTATGGACAAGGCAAAAGAGGAAATTGCTAAAAACTTAGGTGGTGAA GAGAAAAACTACAAGGAGATTTGGGAGATCATTGATGAAAAGTGGGATTTTCAGTTACATCAACATTTACATGCCGCAGC ATACTACTTGAATCCAAGGATTCGATACTCCGATAATCCTTCCAACCATCATGAGATCAAGCTTGTTTTTACCATTGTAT GAATAGGATGTTTAAGGACCCAAATGATCTAGAGAAGGCCGAAGAGAAGGCCGACCTCCAACTAGATGAATTTCGACAGA AGAGAGTTTTTTTGGCCTTTGTCAAGCTCAAGCATCATACATGAAACACAATCCTAGTAAGTAGAAACTATCTTATTAAT TTTGGCTAATAAAACAGTTTAGATTGTTTGTCTAATAATTTTCATCTCAATTTGAATTCAGATGATTGGTGGTCCCAATT TGGAGATGATACCCTAGAGTTGGCTAGCTTTGCAATTAGAGTTTTGAGTCTCACTTGTTCATCTTCGGGATGTGAACGCA ATTGGAGGACCCACAACCAAGTTCATACCAAGAGAA >DTA_3_5_Mno length=2516;Class=DNA transposons;Order=TIR;superfamily=hAT; TGTGATAACCAAGCAGCTATACGGATTGCAAAGAATCCAGTACATCATGACAGAACGAAGCATATCGAGATTGATCGACA TTTCATTGCAGAGAAAATAGAAAAGTCCATTGTGCAGCCGGCTTACATCCCTACTCAATCTCAAGTGGCAGACATCCTCA CTAAGGCCCTACCAAGGACAAGTTTTGAGAAACTGAGTCACAAGCTGTGTTTGTTCAACATATACAAATCAGCTTGAGGG GGAGTGTTGAAATTCAAAATTCAAATTAGGAATTATCCTCAATATAGTTCGGATTGATATTAGGATTAGGATTTGATTTC CTATCTTTAAATTCAGTTTTCCTCTATCTCTTATCTCCTAGTTTAGTGGGATATTTTCCCGATTCTCTTTAACCTAGAAT TTATAGTTGTAGTATATATATATATATATATATTGTACCGATTCAATAAAATTAATAAGAGAGAAAAAGAGGGCAATTTC CTTCTCTGAAAATCTACAGAATGTAAGGCCTTGTCCTCAGGTTCCTGATGATGTGAAGAAAGAAATTAATGACTATATGA ACAAGTGGGCTGTTGAAAAACAGGTAGCGCATCAGAAATTTGAAGAAATGGTGGATGTTGGGTCTTATTATGGTGATGGA TTTGTCGGCTCTTGTCAATCGCCGCAAGTGGTTAGTGATAGAGGAGTTAGAGGTCCCATGGACAGGTTTTTGAACATTGT GGATGATAAGGAAGCAAACGAAAAACCTTCCCTTAGAACGACATCAAGAGAAAAAGAGGCCCGTTCTCGAGTATGTCTCG ACATTGGTAGGTTCTTTTATGAAAATGCACTTGCTTTCAATATTGCTAGGAGCCCCTCCTATTTTAATATGTGTAGATCA ATTGGCGACTATGGTAGAGGTCTTGTACCCCCAAGTATGCATGAGCTTAGAACATGGATTTTGAAGGAGGAAGTACTTAC AACTGAAAAATTTGTGAAGGAAATTAAAATGACTTGGCAACAAACAGGAATTTCTATTTTATCTGATGGTTGGTCGGATG CTAGAAATAGAGGTTTGATCAACTTTTTAGTCAACAATCCTCATGGAACTATTTTCTTGAGATCTATTGATGTCTCTGAT AAAAAGAAAGATGCAAATCTATTGTTTGAGATGCTTGACGAGATTGTTGAAGAAGTTGGTGAAAATCTTGTTGTTCAAGT TGTGACTGACAATACAAGTGCTTATAAGGCTGCTGGAGCAAAACTAATGGAGAAACGAAAACACTTATTTTGGACTTCTT GTGCTGCTCATTGCATTGATTTGATGCTTGAGAAACTAGGAAAATTGCCACAACATAAAAGGGCTTTGTTGAAAGCAAAA AAAATTAGCAATTATGTGTACAATCACCCTTAGGTGTTGTCATTGATGAGAAATTTTACCAAAAGGGATCTTGTTCGACC TGCTGCAACAAGATTTGCTACTGCCTATTTGACTTTGGAGTGCATCTATAGACTAATGCAGCCTCTACAATCTATGTTTG TATCGGAGGAATGGAACAGTAGTTCATATGCAAAGAAACCGGATGGGAAACAAGTGAAAAAGATAGTCATGAAGGATAAT CAGTTTTGGGCTGCTGTTGGGTATGTTCTTAAGTCTACACAACCCATAGTGAAGGTATTAAGAGTTGTCGACTCTGAAAA AATGCCCGCCATGGGATTTATATATGGGGCTATGGATAAGGCAAAAGAGGAAATTGCTAAAAACTTGGGAGGTGAAGAGA AAGACTACAAGGAGATTTGGGAGATCATTGACGAAAAGTGGGATTTTCAGTTGCATCAACATTTACATGCTGCGGCATAC TACTTGAATCCAAGGATTCGATACTCCAATAATCCTTCCAACCATCCTGAGATCAAGCTTGGTTTGTACCATTGCATGAA TAGGATGTTTAAGGACCCAAATGATCTAGAGAAGGCCGACCTCCAACTAGATGAATTTCAACAGAAGAATGGGTTTTTTG GCCTTCGTCAAGCTCAAGGATCATACATGAAACGCAATCCTAGTAAGTAGAAATTATCTTATTAATTTTGACTAATAAAA CAATTTAGATTGTTTGACTAATTATTTTCATCTCAATTTTAAATTCAGATGATTGGTGGTCCCAATTTGGAGATGGTACC CCAGAGTTGGCTAGCTTTGCAGTTAGAGTTTTGAGTTTCACTTGTTCATCTTCGGGATGTGAACGCAATTGGAGTACCCA CAACCAAGTTCATACCAAGAGAAGAAATCGCTTGACTGCACAAAAGATAAATTCCTTGGTCTACATCATGTTCAACAAGA AGCTAAAAGATCGACATTTGAAAAAGAAGGCACTTCAGCAAGATGAGGATCCCTTAATCATTGATGAGTTGCCATCTGAT GATTGAATGGATAGCCGGAAATGAAAATGAAGGCGAAATTCAAACAGAGGAAGCAATTGACAATCTTGACATTGATCTTT TGAGGATGGAGAAGAGGACAGGTTAGTGGCAAGATA >DTA_3_6_Mno length=2516;Class=DNA transposons;Order=TIR;superfamily=hAT; CAGCTCATTCTTCTTCTTCTTCTTCTTCGGCCGACTGCCGACCATCGTGCGCCTCCTTTTTCATCGCTGACTGCCGTGCG CCTCTTTCTTCTTCTTCTTTCCCAGTGCTGTGCCACCTCCTTCTTCGCAAGGTTCCTTCTACTCAACTTTTTTTTTTTTT TTTTTTTTTTTTTCATTTTGAAGGCTTACTCGATTATCTATATGTTAAAAGATTTTTACTCTTATGCATTGATGTTCCTT ATCTGTGTTTATGAGAGAAACAACTATATGCTATATTGTTTGTTTTTCTCTTGTAATTATGGTTTTTTTTTTTTGGTTTA AGTTAGGAATTAGGATGAGACCTCCACAAAATGCTAACGGTAGTCGTAGTAGGAGACGGGATTTGGCTTTGAAATATGAA AAAGAAATTACATCGGAAAATGAAAAAAAAGACTTATGTTTACCTGCAATGTGTGTTTTGCAATCAAATTATTAAAGTAG GTGTTAAGAGGATGAAAGAACACCTTGCTTGCACTCATATGTAAAGCCTTGTCCTAAGGTTCCTGATGATATGAAGAAAG AAATTAAAGTGGGCTGTTGAAAAACAGTTAGCGCATCAGAAATTTGAAGAAATGGTGGATGTTGGGTCTTATTATGGTGA TGGATTTGTCGGCTCTTGTCAATCGCCACAAGTGGTTAGTGATAGAGGAGTTAGAGGTCCCATGGACAGGTTTTTGAACA ATGTGGATGATAAGGAAGCAAAGGAAAGACCTTCCCTTAGAACGACATCAAAAGAAAAAGACGCCCGTTCTCGAGTATGT CTCGACATTGGTAGGTTCTTTTATGAAAATGCACTTGCTTTCCATATTGCTAGGAGCCCCTCCTATTTTAATATGTGTAG ATCAATTGGCGACTATGGTAGAGGTCTTGTACCCCCAAGTATGCATGAGCTTAGAACATGGATTTTGAAGAAGTTCTTAC CATTGAAAAATTTGTAGAGGAGGTTAAAATGACTTGGAAACAAACATGAGTTTCTATTTTATCTTATGGCTGGTTAGATG CTAGAAATAGAGGTTTGATCAACTTTTTAGTCAACAATCCTCATGGAACTATTTTCTTGAGATCTGTTGATGCCTCTGAT AAAAAGAAAGATACAAATCTATTGTTTGAGATGCTTGACGAGATTGTTGAAGAAGTTGGGGAAGATCTTGTTGTTCAAGT TGTGACTGACAATGCAAGTGCTTATAAGGCTGCTGGAGCAAAACTAATGGAGAAATGAAAACACTTATTTTGGACTCTTT GTGCTGCTCATTGCATTGATTTGATCATTGAGAAACTAGGAGAATTGTCACAACATAAAAGGGCTTTGTTGAAAGCAAAA AAAATTAGCAATTATGTGTACAATCACCCTTGGGTGTTATCATTGATGAGAAAGTTTACCAAAAGGGATCTTGTTCGACC TGCTGCAACAAAATTTGCTACTGTCTATTTGACTTTGGAGTGCATCTATAGACTAATGTAGCCTCTACAATCTATGTTTG TATCGGAGGAATGAAACAGTAGTTCATATGCAAAGAAACCGGATGGGAAAGAATTTAAAAAGATAGTCATGAAGGATAAT CAGTTTTGGGCTGCTGTTGGGTATGTTTTTAAGTCTACACAACCCATGGTGAAGGTGTTGAGAGTAATCGACTCTGAAAA GATGCCCGCCATGGGATTTATATATGGGGCTATGGACAAGGCAAAAGAGGAAATTGCTAAAAACTTGGGAGGTAAAGAGA AAGACTACAAGGAGATTTGGGAGATCATTGACGAAAAATGGGATTTTCAGTTGCATCAACATTTACATGCCGCGGCATAC TACTTGAATCCAAGGATTCGATACTCTGATAATCCTTCAAACCATCCTGAGATCAAGCTTGGTTTGTACCATTGCATGAA TAGGATGTTTAAGGACCCAAATGATATAGAGAAGGCCGACCTCCAACTAGATGAATTTCAACAGAAGAATGGGTTTTTTG GCCTTCGTCGAGCTCAAGGATCATACATGAAACGCAATCCTAGTAAGTAGAAACTATCTTATTAATTTTGAGTAATAAAA CAATTTAGATTGTTTGACCAATTATTTTCATCTCAATTTTAAATTCAGATGATTGGTGGTCCCAATTTGGAGATGGTACC CCAGAGTTGGCTAGCTTTGTAGTTAGAGTTTTGAGTCTCACTTGTTCATCTTCGGGATGTGAACGCAATTGGAGTACCCA CAACCAAGTTCATACCAAGAGAAGAAATCGCTTGACTGCACAAAAGATAAATTCCTTGGTCTACATCATGTTAAACAAGA AGCTAAAAGATCGACATTTGAAAAAAAAGGCACTTCAGCAAGATGAGGATCCCTTAATTATTGATGAGTTGCCATGTGAT GATGAATGGATAGCCGGAAATAAAAATGAAGGCGAAATTCAAATAGAGGAAGCAATTGACAATCTTGACATTGATCTTTT TGAGGATGGAGAAAGTACTAGTACTACTACTAGAGC >DTA_3_7_Mno length=2513;Class=DNA transposons;Order=TIR;superfamily=hAT; AATTCTCTAATTCGACAATTCTTATGCATTGATGTTTCCTTATCTGTGTTTATGAGAGAAACATAAACCATTTGTTACAG TTTTCATTTGAAGGCTTACTCTAATATGTGGGTCGTGTTACAAGTGACAAGTGCTATCTTTAGTTTCATAAATATGTAGG TCATGGTACAAGTGACAAGTGTTATTTTACTTCAGCAATATATGGGTCGTGTGTTACAAGTGATAAGGCTTAACAATCTT CAATTATATGTTATATTGTTTGTTTTTCTCTTGTAATTCTGGTTTTTTTTTTCGTTTTTAAGTTAGGAAATAAGATGATA CCTCCACAACATGCTAGCGGTTGTCGTAGTGGGAGACGGGATCCGGCTTGGAAATATGAAAAAGAAATTACATCAAAAAA TGACAAAAGGACTAATGTTTACCTCCAATGTGTGTTTTGCAATCAAATTATTAAAGGAGGTGTTAAGAGAATGAAAGAAC ACCTTGCTTGCACTCATAAGAATGTAAAGCCTTGTCCTAGGTTCTTGATGATGTGAAGAAAGAAACTAATGACTATATGA ACAAGTGGGCTGCTGAAAAACAGTTTGCGCATCAGAATTTTAAAAAAATGGTGGATGTTGGCTCTTATTATAGTGATGGA TTTGTCGACTCTTGTCAACCGCCACAAGTGGTTAGTGATAGAGGAGTTAGAGGTCCCATGGACAGGTTTTTGAACAATGT GGATGATAAGAAAGCAAACGAAAGACCTTCCCTTAGAACGACATCAAGTGAGAAAGAGGCCCGTTCTCGAGTATGTCTCA ACATTGGTAGGTTTTTTTATAAAAATGCACTTGCTTTCAATATTGCTCGGAGCCCCTCCTATTTTAATATGTGTAGATCA ATTGGCAACTATGGTAGAGGTCTTGTACCCCCAAGTATGCATGAACTTAGAACATGGATTTTGAAGGAGGAAGTACTTAC CACTGAAAAATTTGTGGAGGATGTTGAAATGACTTGGAAACAAACAGGAGTTTCTATTTTATCTGATGGTTGGTCAGATG CTAGAAATCGAGGTTTGATCAACTTTTTAGTCAATAATCCTCATGGAACTATTTTCTTGAGATCTATTGATGCCTCTGAT AAAAAGAAAGATGCAAATCTATTGTTTGAGATGCTTGATGAGATTGTTGAAGAAGTTGGGGAAGATCTTGTTGTTCAAGT TGTGACTGACAATGCAAGTGCTTATAAGGCTACTGGAGCAAAACTAATGGAGAAAAGAAAAAAAAAACACTTATTTTGGA CTCCTTGTGATGCTCATTGCATTGATTTGATACTTGAAAAATTAGGAGAATTGCCACAACATAAAAAGGCTTTGGTGAAA GCAAAAAAGTTAGCAAATGTGTATAATCACCATTGGGTGTTGTCATTGATGAGAAAGTTTACTAAAAGGGATCTTGTTCG ACCTGCTACAACAAGATTTGCTACTGCCTATCTGACTTTGGAGTGCATCTATAGACTAATGCAGCCTCTACAATCTATGT TTGTATCGGAGGAATGGAACACTAGTTCATATGCAAAGACACCAGATGGGAAAGAAGTGAAAAAGACAGTCATGAAGGAT AATCAGTTTTGGACTGTTGTTGGGTATGTTCTTAAGTCTACACAACCCATAGTGAAGGTGTTGAGATTAGTCGACTCTGA AAAGATGTCCCCCTTGGGATTTATATATGGGGCTATGCACAAGGCAAAAGAGGAAATTGCTAAAAACTTGGGAGGTGAAG AGAAAGACTACAAGGAGATTTGGGAGATCATTGACGAAAAGTAGGATTTTCAATTGCATCAACATTTGCATGCCGCAACA TACTACTTGAATCTAAGGATTCGATACTCCGATAATCCTTCCAACCATCCTGAGATCAAGCTTGGTTTGTACCATTGCAT GAATAGGATGTTTAAGGACCCAAATGATCTAGAGAAGGCCGACCTCCAACTAGATGAATTTCGACAGAAGAAAGGGTTTT TTGGGCTTCGTCAAGCTCAAGTATCATACATGAAATGCAATCCTAGTAAGTAGAAACTATCCTATTAATTTTGACTAATA AAACAGTTTAGATTGTTTGGCTAATTATTTTCATCTTAATTTTAAATTCAGATGATTGGTGGTCCCAATTTGGAGATGAT ACCCTAGAGTTGGCTAGCTTTGCAGTTAGAGTTTTGAGTCTCACTTGTTCACCTTCGGGATGTGAACGCAATTGGAGTAC CCACAACAAAGTTCATACAAAGAAAAGAAATGCACAAAAGATAAATTCCTTGGTCTACATCATGTCCAACAAGGAGCTAA AAGATCGACATTTGAAAAAAAAAGGCACTTTAGCAAGATGAGGATCCCTTAATCATTGATGAGTTGCCATCTGATGATGA ATGGATAGCTGGAAATGAAAATGAAGGTGAAATTCAAAGGAATGAAGCAATTGACAATCTTGACATTGATCTTTTTGAGG ATGGAGAAGGTACTAGTACTAGTACTAGAGCTA >DTA_3_8_Mno length=2512;Class=DNA transposons;Order=TIR;superfamily=hAT; GGTAGACCAGCCACTTGCACAGCCGTCTCTCCTCATCCTCCTCCTTCTTCTTCTTCTTCCTCGCACGGGCAAACAGTCTC CTTCCCGTGTTCCTCAATTGGCTGCTACATCAACCAAAAGCAAACCGGCCACTTGCCGACTCTTCAAGTGAGGTATCTCT CTTCTCTTGACTTGACGTCCATTTTTTGTAAAATGCACCGTGAATAATAGGATTTGAGTATTGATACGAACTGATTGTGT TTAAGTTAGGATGAGAGTATGAGACCTCCACAAAATGCACCGTGACTTGACATCAATTTTTTTGTTCAAGTTAGGATGAG ACCTCCACAAAAATGCTAGCAGTAGTTATAGTGGGAGACGGGACCCGGCTTGGAAATATGAAAAAGAAATTACAACGGAA AATGAAAAAAGAACTTATGTTTACCTCCAATGTGTGTTTTGCAATCAAATTATTAAAGAAGGTGTTAAGAGAATGAAAGA GCACCTTGCTTGGACTCATAAAAATGTAAAGCCTTGTCCTAAGGTTCCTGACGATTTGAAGAAAGAAATTAATGACTATA TGAACAAGTGGGCTACTAAAAAACAGTCAGCGCATCAGAATTTTGAAGAAATGGTGCATGTTGGCTCTTATTTTGGTGAT AGATTTGTCGACTCTTGTCAACCACCGCAAGTGTTTAGTGATAGAGGAGTTAGAGGTCCCATGGACAGGCTTTTGAACAA TGGATGACAAGGAAGCAAAGGAAAGACCTTCCCTTAGAACAACATCATGTGAGAAAGAGGCCCGTTCTCAAGTATGTCTC GACATTGGGGTTCTTTTATGAAAATACACTTGCTTTCAAAATTGCTAGAAGCCCTTCCTATTTTAATGTGTAGATCAATT GACAACTATGGTAGAAGTCTTGTACCCCCAAGTACGCATGAGCTTAGAACATGAATTTTGAAAGAGGGAGTACTTACTAC TGAAAAATTTGTGGATGAGGTTAAAATGACTTGGAAGCAAACATGAGTATCTATTTTATTTGATGGCAGGTCGGATGCTA GAAATCAAGGTTTGATCAACTTTTTAGTCAACAATCCTCATGGAACTATTTTCTTGAGATCTGTTGATGCCTCTGATAAA AAGAAAGATGCAAATTTATTGTTTAAGATGCTTGACGAGATTGTTGAAGAAGTTAGGGAAGATCTTGTTGTTCAAGTTGT GACTGACAACGCAAGTCCTTATAAGGCTGCTGGAGCAAAACTAATAGAGAAAAGAAAACACTTATTTTGGATTCCTTGTG CTGCTCATTGCATTGATTTGATCCTTGAGAAACTAGGAGAATTGCCACAACATAAAAGGACTTTGGTGAAAGTGAAAAAA TAAGCAATTATGTGAATAATCACCCTTGGGTGCTGTCATTGATGAGAAAGTTCACCAAAAGGGATATTGTTCGACCTGCT GCAACAAGATTTGCTACTGCTTATCTTACTTTAGAGTGCATCTATAGACTAATGCAGCCTCTACAATCTATGTTTGTATC GGAGGAATGGAACAATAGTTCATATGCAAAGAAACCGGATGGGAAAGAAATGAAAAAGATAGTCATAAAGAATAATCAAT TTTGGGATGTTGTTGGGTATGTTCTTAAGTCTACACAATCCATAGTGAGGATGTTGGCCCCGTTCATTTCGCCGATTCGA GTTTAGAATTTGAGTTTTGCTACAGTAAAAAGCTCTCAAAAACAATCACATCTTACTTTTTTGCTACAGTAAAAAACTCT CACACAAAATCACATCTCAACTCGAATCAACGAAGTGAACGGGCCCGTTGAGATTAGTCGACTCTGAAAACACGCCCGCC ATGGGATTTATATATGAGGCTATGGACAAGGCAAAAGAGCAAATTGCTAAAAACTTAGAAGGTGAAGAGAAATACTACAA GGAGATTTGGGAGATCATTGATGAAAAGTGGGATTTTCAGTTATATCAACATTTACATGCCGCGGCATACTACTTGAATC CAAGGATTCAATACTCCGATAATCCTTCCAACTATCCTAAGATCAAGCTTGGTTTGTAGCATTACATGAATAGAATGTTT AAGGATCCAAATGATCTAGAGAAGGCCGACCTCCAACTAGATGAATTTCGACAGAAGAAAGGGTTTTTTGGCTTTCGTCA AGCTCAAGCATCATACATGAAACGCGATCCTAGTAAAGTAGAAACTATCTTATTAATTTTGGCTAATAAAACAATTTAGA TTGTTTAGCTAATTATTTTCATCTCAATTTTAAATTCAGATGATTGGTGGTCCCAATTTGGAGATGCCAGAGTTGGCTAG CTTTGCAGTTAGAGTTTTGAGTCTCACTTGTTCATATTCGGGGTGTGAACGCAATTGGAGTACCCACAATCAAGTTCATA CCAAGAGAAAAAATCGCTTGCCTGCACAAAAGATAAATTCCTTGGTCTACATTATGTTCAACAAGAAGCTAAAAGATCAA CATTTGAAAAAAAAAAAGGCACTTCAGCCAGA >DTA_3_9_Mno length=2510;Class=DNA transposons;Order=TIR;superfamily=hAT; AAACCGACCACTACAGCCAAATCTCTGTGGTTCTTCGCGCCTCCTTCTTCTTCTTCACGACTCCTTCTTTGCCGACCGTC GTGCGCCGCCTTCTCCATCTTCTTCTTCGCCGACCACCATGCGCCGCCTCCTCCTTCTTCGCAAGGTTCCACTGCTCCTC TGCTCCAACCAACCACGGCCGCACGAGTCATCGGTATCTAATCTCTTCTTGGATTTTTCTTTTCTTTTCATTTTGTAGTG GCAATGTAGCATTCTAGCAAAGTTCGACCATGAATGAATTTTTGGGTTTAAACTTTAATGTTTTGTTTTTTCTGTTTTTT TTTTGTTTGTTTAAGTTCAGAATTAGGATAAGACCTCCACAAAATGCTAGCGGTAGTCGTAGTGGGAGACGGGATCTAGC TTGGAAATATGGAAAAGAAATTACATCAGAAAATGACAAAAGGACTTATGTTTACCTCCAATGTGTGTTTTGCAATCAAA TTATTAAAGGAGGTGTTAAGAGAATGAAAGAACACCTTGCTTGCACTCATAAGAATGTAAAGCCTAGCCCTAAGGTTCCA TATGATGTAAAGAAAGAAATTAATGACTATATGAACAAGTGGGCTGGTGAAAAACGGTTAGCGCATCAGAAATTGGAAGA AATGGTGGATGTTGGCTCTTATTATGGTAATGGATTTGTCGACTCTTGTCAATCGCTGCGAGTGGTTAGTGATAAAGGAG TTAGAGGTCCCATTGATAGGTTTTTGAACAATGTGGATGATAAGGAAGAAAATGAAAGAGCTTCTCTTAGAACGACATCA AGTGATAAAGAGGCTCGTTCTCGAGTAAGTCTCGACATTGGTAGATTCTTTTATGAAAATGCACTTACTTTCAATATTGC TAGGAGCCCCTCCGATTTTAATGTGTACATCAATTGGTAACTATGGTAGAGGTCTTGTACCCCCAAATATGCATGAGCTT AGAAGATGGATTTTGAAGGAGGAAGTTCTTACCACTGAAAATTTGTGGAGGAGGTTAAAATGACTTGGAAACAAACAGAA ATTGAGGTTTGATAAACTTTTTAGTCAACAATCCTCATGGAACTATTTTCTTGAGATCTGTTGACGCCTCTGATAAAAAG AAAGATGCAAATCTTTTGTTTGAGATGCTTGACGGGATTGTTGAAGAAGTTGGGGAAGATCTTGTTGTTAAGTTGTAATT GACAATGCAAGTGCTTTTAAGGTTGCTAGAGCAAAACTAATGGAGAAAAGAAAACACTTATTTTGGACTCTTGTGCTGCT TATTGCATTGATTTGATCCTTGAGAAACTAGGATAATTGCTACAACATAAAAGGGCTTTGGTTAAAGCAAAAAAAAAATT AGTATTTATGTGTATAATCACCTTTGGGTGTTGTCATTGATGAGAAAGTTTACCAAAAGGGATCTTCTTCGACCTGCTGC AACAAGATTTGCTACTGCCTATCTGACTTTGGAGTACATCTATAGACTAATGCAACCTCTACAATCTATGTTTGTATTGG AGGAATGGAACAGTAGTTCATATGCAAAGAAACTGGATGGAAAAGAAGTGAAAAAGATAATCGTGAAGGATGATCAGTTT TGGGCTGCTGTTGGGTATGTTCTTAAGTCTACACAACTCATAGTGAAGGTGTTGAGATTAGTCGACTCTAAAAAGATACC CGCCATGGGATTTATATATGGGGCTATGGACAAGGCAAAAGAGGAAATTGCTAAAAACTTGGGAGGTGAAGAGAAAGACT ACAAGGAGATTTGTGAGATCATTGACGAAAAGTGAGATTTTCAGTTGCATCAACATTTACATGCCGCAGCATACTACTTG AATCCAAGGATTCGATACTCCGATAATCCTTCCAACCATCCTGAGATCAAGCTTGGTTTGTATCATTACATGAATTGGAT GTTCAAGGATCCAAATGATATAGAGAAGGTTGACCTCCAACTAGATGAATTTCAACAGAAGAATGGGTTTTTTGGTCTTC GTCAAGCTTAATAATTGATGAGTTGCCATCTGATGATGAATGGATAGCTGGAAATGAAAATGAAGGCGAAATTCAAATAG AGGAAGCAATTGACAATCTTGACATTGATCTTTTTGAGGATGGAGAAGGTACTAGTACTACTAGTAGAGCTCAAAAAAGC TCTAAAAATAAGAGGACAGGTTAGTCGCTTGATATGCCTTATGAATTATTAGTTGTCTTCTCTATTATTTACTCTAATTA TCATATAAGAGATAGTAACTTAAGTTTAATTTTGATTATTAGATGATAGAGACAAGGAGATCATGCAAGAGGATGAAGAA GAAGAGTAGATAGACTATGATTCTGACAGTGACAGTCAAGAATTTGTGGACAATGAGAGATTTAAATTTGTTGATGCTTC TCTTAGTAGTGATGATGATTAATGAGTTGGGAGATTAAGCTTTTAGAAGTGCATTATGAACCTTATGATATTAGAATTTG ATAACTACTTAGTATTTATGTGGATATTTG >DTA_3_10_Mno length=2510;Class=DNA transposons;Order=TIR;superfamily=hAT; TCTTCTTCTTCTTCTTCTTCGTGCTAACCGCCGACCACCGTGCGCCTCCTTCTTCATCGCCGACCGCCATGCGCCTCTTT CTTCTTCTTCTTCTTTCCCGGTGCCGTGCCACCTCCTTCTTCGCAAGGTTCCTTCTACTCAACTTTTTTTTTTTTTTTTT CATTTTGAAGGCTTACTCGATTATCTATATATTAAAGATTTTTATTCTTATGCATTGATGTTCCTTATATGTGTTTATGA GAGAAACAACTATATGCTATATTATTTGTTTTTCTCTTGTAATTCTGATTTTTTTTCTGGTTTAAGTTAGGGAAAAAAAA TTAGGATGAGACCTCCACAAAATGCTAGCGGTAGTCGTAGTGGGAGACGGGATCTGGCTTGAAAATATGGAAAAGAAATT ACATCATAAAAAGAAAAAAAGACTTATATTTACCTCCAATGTGTGTTTTGTAATCAAATTATTAAGAGGATGAAAGAACA CCTTGCTTGCGCTCATAAGAATGTAAGGCCTTGTCCTAAGGTTCCTGATGATGTGAAGAAAGAAATTAATGACTATATGA ACAAGTGAGCTGTTGAAAAACAGGTAGCGCATCATAAATTTAAAGAAATGGTGGATGTTGGGTCTTATTATGGTTATGGA TTTGTCAGCTATTGTCAATCGCCGCAAGTGGTTAGTAATAGAGGAGTTAGAGGTCCCATGGACAGGTTTTTGAACAATGT GGATAATAAGGAAGCAAACGAAAGACCTTCCCTTAGAAGGACATCAAGAGAAAAAAATGCCCGTTCTCGAGTATGTCTCG ACATTGGTAGGTTCTTTTATGAAAATGCATTTGCTTTCAATATTGCTAGGAGCCCCTCCTATTTTAATATGTGTAGATCA ATTGGCGACTATGGTAGAGGTCTTGTACCCCCAAGTATGCATGAGCTTAGAACATGGATTTTGAAGGAGGAAGTGCTTAC CACTGAAAAATTTGTGGAGCAAGTTAAAAAGACTTGGAAACAAACAGGAGTTTCTATTTTATCTGATGGCTGGTCAGATG CTAGAAATAAAGGTTTGATCAACTTTTTAGTCAACAATCCTCATTGAACTATTTTCTTGAGATATGTTGATACCTCTGAT AAAAAGAAAGATGCAAATCTATTGTTTGAGATGCTTGACGAGATTGTTAAAGAAGTTGAGGAAGATCTTGTTGTTCAAGT TGTGACTGACAATACAAGTGCTTATAAGGCTGCTGGAGCAAAACTAATGGAGAAACGAAAACACTTATTTTGGACTCCTT ATGCTGCTCATTGCATTGATTTGATTTTTGAGAAACTAGGAGAATTACCACAACATAAAAGGGCTTTGTTGAAAGCAAAA AAAATTAGCAATTATGTGTACAATCACCCTTGGGTGTTGTCATTGATGAGAAAGTTTACCAAAAGGGATATTGTCCGACC TGCTGCAACAAGATTTGCTACTGCCTATTTGACTTTGGAGTGCATCTATAGACTAATGCAGCCTCTACAATCTATGTTTG TATCGGAGGAATGGAACAATAGTTCATATGCAAAGAAACCGGATGGAAAAGAAGTGAAAAAGATAGTCATGAAGGATAAT CAGTTTTGGGTTATTGTTGGGTATGTTCTTAAGTCTACACAACCCATAGTGAAGGTGTTGAGAGTTGTCGACTCTGAAAA GATGCCCGCCATGGGATTTATATATGGGGCTATGGAAAAGGCAAAAGAGGAAATTGCTAAAAACTTGGGAGGTGAAGAGA AAGACTACAAGGAGATTTGGGAGATCATTGACGAAAAGTGAGATTTTCAGTTGCATCAACATTTACATGCTGCGGCATAC TACTTGAATCCAAGGATTCGATACTCCAATAATCCTTCCAACCATCCTGAGATCAAGCTTGGTTTGTACCATTATATGAA TAGGATGTTTAAGGACCCAAATGATCTAGAGAAGGCCGACCTCTAACTAGATGAATTTCAACAGAAGAATGGGTTTTTTG GCCTTCGTCAAGCTCAAGGATCATACATGAAACGCAATCCTAGTAAGTAGAAACTATCTTATTAATTTTGACTAATAAAA CAATTTAGATTGTTTGACTAATTATTTTCATCTCAATTTTAAATTTAAATGATTGGTGGTCCCAATTTGGAGATGGTACC CCAGAGTTGGCTAGCTTTGCAGTTAGAGTTTTGAGTCTCACTTGTTCATCTTCGGGATGTGAACGCAATTGGAGTACCCA CAACCAAGTTCATACCAAGAGAAGAAATTGCTTGACTGCACAAAAGATAAATTCCTTGGTCTACATCATGTTCAACAAGA AGCTAAAAGATCGACATTTGAAAAAGAAGGCACTTCAGCAAGATGAGGATCCCTTAATCATTGATGAGTTGCCATCTGAT GATGAATGGATAGCCGGAAATGAAAATGAAGGCGAATTCAAACAGAGGAAGCAATTGACAATCTTGACATTAATCTTTTT GAGGATGGAGAAGTTACTAGTACTAGAGCT >DTA_3_11_Mno length=2509;Class=DNA transposons;Order=TIR;superfamily=hAT; GCGCCTCCTTCTTCTTCTTCACAACTCCTTCTTCTTCTTCACCGACCATCGTGCGCCTCCTCCTTCGTTGACTAACGTGC GTCTCCTCCTTCTTCATTGTGCGACCTCCTCCTTCTTCGCAAGGTTCCTCTGCTCCTCTGCTCCAACCAGCCCCAGCCAC ATGAGGCTTCACAAGGTATCTAATCTCTTGTTGGCTTTTTTTTTTTTTTTTTCATTTTGTAGTAGCAATGAAGCATTCTA GCAAAGTTTGATCGTGAATGACTTTTTGGGTTTAAAATCTAATGTTTCATTTTTTTTTAAGTTAGGAATTAGGATGAAAC CTCCACAAAATGCTAGCGGTCGTCGTAGTGGGAGACAAAATCCGGCTTGGAAATATGGAAAGGAAATTACATCAGAAAAT GACAAAAGGACTCATGTTTACATCCAATGTGTGTTTTGCAATCAAATTATTAAATGAGGTGTTAAGAGGATGAAAGAACA CCTTGCTTGCAGTCATAAGAATGTAAAGCCTTGTCCTAAGGTTCCTGATGATGTGAAGAAAGATATTAATGACTATATGA ACAAGTGGGCTATTGAAAAACAGTTAGCGCATCAGAAATTTCAAGAAATGGTTGATGTTGGCTCTTATTATGGTGATGGA TTTGTCGACTCTTGTCAATCACCGTGAGTGGTTAGTGATAGAGGAGTTAGAGGTCCCATGGATACATTTTTGAACAATGT GGATGATAAGGAAGCAAACGAAAGACCTTCCCTTAGAACGACATCAAGAGATAAAGCGGCCCGTTCTTGAGTATGTGTCG ACATTGATAGGTTCTTTTATGAAAATGCACATGCTTTCAATATTGCTAGGAGCCCCTCCTATTTTAATATGTATAGATCA ATTGGCAGCTATGGTAGAGGTCTTGTACCCCCAACTATGCTTGAGCTTAGAACATGGATTTTGAAGGAGGAAGTACTTAC CACTGAAAAATTTGTGGAGGATGTTAAAATGACTTAGAAACAAACAGGAGTTTCTATTTTATCTGATGGCTGGTCGGATG CTAGAAATTGAGGTTTGATCAACTTTTTAATCAACAATCCTTATGAACTATTTTCTTGAGATATGTTGATGCCTCTGATA AAAAGAAAGATGTAAATCTATTGTTTAAGATGCTTGAAGAGATTGTTGAAGAATTTGGGGAAAATCTTGTCATTCAAGTT GTGACTAACAATGCAAGTGCTTATAAGGCTGCTGGAGCAAAACTAATAGAGAAAAGAAAACACTTATTTTGGACTTCCTG TGCTGCTCATTGCATTGATTTGATCCTTGAGAAACTAGGAGAATTGCCACAACATAAAAGGGCTTTGGTGAAAGCAAAAA AAAATAGTAATTATGTGTATAATCACCCTTGGGTGTTGTCATTGATGAGAAAGTTTACCAAAAGGGTTCTTGTTTGACCT GCTGCAACAAGATTTGCTACTACCTATCTGACTTTGGAGTGTATCTATAGACTAATGCAACCTCTACAACCTATGTTTGT ATTAGAGGAATGGAACAGTAGTTCATATGCAAAGAAACTGGATGGGAAAGAAGTGAAAAAGATAGTCATGAAGGATAATC AGTTTTGGGCAGCTGTTGGGTATGTTCTTAAGTCTACACAACCTATAGTGAAGGTGTTGAGATTAGTAGACTCCAAAAAG ATGCCTGCCATGGGATTTATATATGGGGCTATGGACAAGGCAAAAGAGGAAATTGCTAAAAACTTTGGAGGTGAAGAGAA AGACTACAAGGAGATTTGGGAGATGATTGACAAAAAGTGGGATTTTCAGTTGCATCAACATTTATATGCCGCGGCATATT ACTTGATTTCAAGGATTCAATACTCCGATAATCCTTCCAACCATCATCTAGAGAAGGCCGACCTCCAACTAGATGAATTT TGACAAAAGAATGGTTTTTTTGGCCTTCCTCAAGCTCAAGCATTATACATGAAACGCAATCCTAGTAAGTAGAAACTATC TTGTTAATTTTGACTAATAAAACAATTTAGATTGTTTGACTAATTATTTTCATCTCAATTTTAAATTCAGATGATTGGTG GTCCCAATTTGGAGATGGTACCCCAGAGTTGGCTAGCTTTGCAGTTAGAGTTTTGAGTCTCACATGTTCACTTTCGGGAT GTGAACGTAATTGGAGTACCCACAACCAAGTTCATACTAAGAGGAGAAATCGCTTGACAGCACAAAAGATAAATTCCTTC GTCTACATCATGTTCAACAAGAAGCTAAAAGATTGACATTTGAAAAAAAAGGCACTTCAGCAAGATGAGAATCCCTTAAT CATTGATGAGTTGCCATCTGATGATGAATGGATAGCTGGAAATGAAAATGAAGGCGAAATTCAAACGGAGGAAGCAATTG ACAATCTTAACATTGATCTTTTTGAGGATGGAGAAAGTACTAGTACTAGTACTAGAGCTCAAAAAAGCTCTAAGAGGAAA GATTAGTGGCAAGATATGCCGTATGAATT >DTA_3_12_Mno length=2502;Class=DNA transposons;Order=TIR;superfamily=hAT; CGCCGACCACCGTGCACCTCCTTCTTCATCGCCGACCGCCGTGCCTCGTTCTTCTTCGTAGCTCCTTCTTCCTCTTCTTC TTCGCAACTCCTTCTTCGCAAGGTTCCTTCTACTCAACTTTTTTTTTTTCATTTTGAAGGCTTACTCGATTATCTATATA TTAAAGATTTTTATTCGTATGCATTGATGTTCCTTATCTGTGTTTATGAAAGAAACAGCTATATCCTATATTGTTTGTTT TTCTCTTGTAATTCTAGTTTTTTTTTTTTTTTTTCTGGTTTAAGTTAGGAATTAGGATGAGACCTCCACAAAATGCTAGC GGTAATCATAGTGGGAGACGGGATCCGGCTTGGAAATATGGAAAAGAAATTACATCGGAAAATGACAAAAAGACTTATGT TTACCTCCAATGTGTGTTTTGCAATCAAATTATTAAAGGAGGTGTTAAGAGGATGAAAGAACACCTTGCTTGCACTCATA AGAATGTAAAGCCTTGTCCTAAGGTTCCTGATGATGTGAAGAAATAAATTAATGACTATGAACAAGTGGGCTGTTGAAAA ACAGTTAGCGCATAAGAAATTTGAAGAAATGGTGGATGTTGGCTCTTATTATGGTGATGGATTTGTCGACTCTTGTCAAT CGCCGCAAGTGGTTAGTGATAGAGGAATTAGAGGTCCCATGGACAGATTTTTGAACAATGTGGATGATAAGGAAGCAAAC GAAAGACCTTCCCTTAGAACGACATCAAGAGATAAAGAGGCTCGTTCTCGAGTATGTCTTGACATTGGTAGGTTCTTTTA TGAAAATGCACTTGCTTTCAATATTGCTAGGAGTCCCTCATATTTTAATATGTGTAGATCAATTGGAGACTATGGTAGAG GTCTTGTACCCCCAAGTATGCATGAGCTTAGAACATGGATTTTGAAGGAGGAAGTACTTACCACTGAAAAATTTGTGGAG GCGGATAAAATGACTTGGAAACAAACAGGTGTTTGATGTTTCTATTTTATCTGATGGCTGGTCGGATGCTAGAAATCGAG GTTTGATCAACTTTTTAGTCAACAATCCTCATGGAACTATTTTCTTGAGATTTGTTGATGTCTCTGATAAAAAGAAAGAT GCAAATCTATTGTTTGAGATGCTTGACGAGATTGTTGAAGAAGTTGGGGATGATCTTGTTGTTCAAGTTGTGACTGACAA TGCAAGTGCTTATAAGGCTGCTGGAGCAAAACTAATGGAGAAACGAAAACACTTATATTGGACTCCTTGTACTGCTCATT GCATTGATTTGATCCTTGAGAAACTAGGAGAATTGCCACAACATAAAAGGGCTTTGGTGAAAGCAAAAAAAAATTAGCAA TTATGTGTACAATCACCATTGGGCGTCATTGATGAGAAAGTTTACCAAAAGGGATCTTGTTCGACCTGCTGCAACAAGAT TTGCTACTGCCTATTTGACTTTGGAGTGCATCTATAGACTAATGCAGCATCTACAATCTATGTTTGTATCGGAAGAATGG AACAGTAGTTCATATGCAAAGAAACCGGATGGGAAAGAAGTGAAAAAGATAGTCATGAAGGATAATCAGTTTTGGGCTGC TGTTGGGTATGTTCTTAAGACTACACAACCCATAGTGGAGGTGTTGAGGGTAGTCGACTCTGAAAAGATGCCCGCCATGG GATTTATATATGGGGCTATGGACAAGGCAAAAGAGAAAATTGCTAAAAACTTGGGAGGTGAAGAGAAAGACTACAAGGAG ATTTGGGAGATCATTGACGAAAAGTGGGATTTTCAGTTGCACCAACATTTACATGCCGCGGCATACTACTTGAATCCAAG GATTCGAATACTCCGATAATCCTTCCATCAATCCTGAGATCAAGCTTGGTTTGTTGCATGAATAGGATGTTTAAGGACTC AAATGATCTAGAGAAGGCCGACCTCCAACTAGATGAATTTCAACAGAAGAATGGGTTTTTTGGCCTTCGTCAAGCTCAAA GATGATACATGAAACGCAATCCTAGTAAGTAGAAACTACCTTATTAATTTTGACTAATAAAACAATTTAGATTGTTTGAC TAATTATTTTCATCTCAATTTTAAATTCAAATGATTGGTGGTCCCAATTTGGAGATGGTACCCCAGAGTTGCCATCTGAT GATGAATGGATAGCCATAAATGAAAATGAAGGCGAAATTCAAACAGAGGAAGCAATTGACAATCTTGACATTGATCTTTT TGAGGATGAAGAAGGTACTAGTACTAGTACTAGAGCTCAAAAAAGCTCTAAAAAGAAGAGGACAAGTTAGTGGCAAGATA TGCCATATGAATTATTAGTTGTCTTTTCTATTATTTACTCTAATTATCATATAAGAGATAGTAACTTAAGTTTAATTTTT ATTATTAGGTGATATAGGCAAGGAGATCGTGCAAGAGGATGAAGAAGAAGAGTGGATAGACTGTGATTCTGACACTAACA GTCAAGAATTCGTGGACAATGA >DTA_3_13_Mno length=2481;Class=DNA transposons;Order=TIR;superfamily=hAT; TAGGATTGAAGTTATTCGTAGTAAAGTAGGTGTAGCACCAATAGAAGATAAGATGCGCGAAGGCCGCTTGAGGTGGTACA GGCATGTCCAACGTAGACCGCTAGAAGCACCAGTTCATGCTTGGGAGGACATTCTTATACCTACTAGGAGACGGAGGGGT AGACTAAGAATTACGTGGACTGATGTAGTTAGGAAAGACATTTTAGATCTAGGCCTTCAGGAAAGTTTAATTTCTAACAG AGTTGCGTGGAAAAGTGAAATCCATATAGCTGACCCTAATTAAGTTGGGATTAAGGCTTGTTGTTATTGTAGTTAGGAAT TAGGATGAGACCTCCACAAAATGCTAGCGGTAGTCGTAGTGGGAGACAGGATCCAGCTTGGAAATATGGAAAAGAAATTA CATCGAAAAATGACAAAAGGACTTTATTTTTACTTCCAGTGTGTGTTTTGCAATCAAATTATTAAAGGTGTTAAGAGAAT GAAAGAACACCTTGCCTGCACTCATAAGAATGTAAAGCCTTGTTGTAAGGTTCCTGATGATGTGAAGAAAGAAATTAATG ACTATATGAACAAGTGGGCTGCTGAAAAACAATTAACGCACCAGAATTTTGAAAAAATGGTGGATGTTGGCTCTTATTAT GGTGATGGATTTGTCGACTCTTGTCAACCGCCGCAAGTGGTTAGTGATAGAGGAGTTAGAGGTCCCATGGACAGGTTTTT GAACAATGTGGATGATAAGGAAGCAAATGAAAGAGTTTCCCTTAGAACGACATCAAGTGAGAAAGAGGCCCGTTCTCGAG TATGTCCCGACATTGGTAGGTTCTGTTATGAAAATGCACTTGCTTTCAATATTGCTAGGAGCCCCTCTTATTTTAATATG TGTAGATCAATTGGCAACTATGGTAGAGGTCTTGTACCCCCAAGTATGCATGAGCTTAGAACGTGGATTTTGAAGGAGGA AGTACTTGCCACTGAAAAGGTTTAAATGACTTGGAAACGAACAGGAGTTTATATTTTATATGATGGCTGGTCGGATGCTA GAAATCGAGGTTTGATCAACTTTTTAGTCAACAATCATCATGGAACTATTTTCTTGAGATCTGTTGATGCCTCTGATAAA AGGAAAGATGCAAATTTATTGTTTGAGATGCTTGACGATATTGTTCAAGAAGTTGGGGAAGATCTTGTTGTTTAAGTTGT GACTGACAATGCAAGTGCTTATAAGGCTAGAGCAAAACTAATGGAGAAAAGAAAACACTTATTTTGGATTCCTTGTGCTG CTCATTGCATTATTTTGATTCTTGAGAAACTAGGAGAATTGCCACAACATAAAAGGGCTCTAGTGAAAGCAAAAAAAAAA AATTAGCAATTATGTTTATAATACCAAAAGGGATCTTGTTCGACCTGCTGCAACAAGATTTGCTATTGCTTATTTGACTT TGGAGTGCATCTATAGACTAATGCAGCCTCTACAATCTATGTTTGTATCAGAGGAATGGAACAATAGTTCATATGCAAAG AAATGGGATGGGAAAGAAGTGAAAAGGATAGTTATGAAGGATAATTAGTTTTGGACTATTGTTGGGTATGTTAGTAAGTC TACACAACCCATAGTGAAGGTGTTGAGATTAGTCGACTCTAAAAGATGCCCGCCATGGGGTTTATATATGGGGCTATGGA CAAGGCAAAAGAGGAAATTGCTAAAAACTTGGGAGGTGAAGAGAAAGACTACAAGGTGATTTGGGAGATCATTGATGAAA AGTGAGATTTTCAGTTACATCAACATTTACATGCCGCAGCATACTACTTGAATCTAAGGATTCGATACTCTGATAATCCT TCCAACCATCCTGAGATCAAGCTTGGTTTTGTACCATTTCATGAATAGGATGTTTAAGGACCCAAATGATCTAGAGAAGG CCGACCTCCAACTAGATGAATTTTGACAGAAGAAAGGGTTTTTTGGCCTTTGTCAAGCTCAAGCATCATACTTGAAACAC AATCCTAGTAAGTGGAAAGAAACTATCTTATTAATTTTGACTAATAAAACAGTTTAGATTGTTTGGCTAATTATTTTCAT CTCAATTTTAAATTCAGATGATTGGTGGTCCCAATTTGGAGATGGTACCCCTGAGTTGGCTAGCTTTGTAGTTAGAGTTT TGAGTCTCACTTGTTCATCTTCGGGATGTGAATGCAATTGCAGTATCCACAACCAAGTTCATACCAAGAGAAGAAATCGC TTGACTGCATAAAAGATAAATTCCTTGGTCTACATGATGTTCAACAAGAAGCTAAAAGATGGACATTTGAAAAAAAAAAG GCACTTTAGCAAGATGAGGATCCCTTTATCATTGATGAGTTCCATCTGATAATGAATGGATAGCTGGAAATGAAAATGAA GGTGAAATTCAAACAGAGGAAGCAATTGACAATCTTGACATTGATCTTTTTGAGGATGGAGAAGGTACTAGTACTAGTAC T >DTA_3_14_Mno length=2475;Class=DNA transposons;Order=TIR;superfamily=hAT; TTTTCATTTTAAAGGCTTACTTTAATATGTATATTAGAAATTTTTATTCTTATGCATTGATGTTCGGTGTTCCTTATCTG TGTTTATGAGAGAAACCATTTGTTACAGTGGCCACTTTTTGCCATTTTAATTTATGTTGTACGTAGCTTATCCAAAGGTC GATTAAGTGGGTCGTGTTACATGTGACAAGTGTTATCTTTAGTTTCATAAATTAGTTTTGATTTGTCATTAGAAGTTTTG AAGTCTTAACAATCTTCAATTATATGCTATATTGTTTGTTTTTTCACTTGTATTTTGTGTGTGTGTGTTTAAGTTAGGAA TTAAGATGAGACCTCCCCAAAATGCTAGCGGTAGTTGTAGTGGGAGACGGAATCTGGCTTGAAAATATGGAAAAGAAATT ACATCGGAAAATGACAAAAGGACTTATGTTCACCTTTAATGTGTGCTTTGCAATCAAATTATTAAATGAGGTGTTAAGAG AATGAAAGAACACCTTGCTTGCACTCATAAGAATGTAAAGCCTTGTCCTAAGGTTCCTGATGATGTGAACAAGTGGGCTG TTGAAAAACAGTTAGTGCATCAGAATTTTGAAGAAATTGTGGATGTTGGCTCTTATTATGGTGATGGATTTGTCGACTCT TGTCAACCGCCGCAAGTGGTTAGTGATAGAGGAGTTAGAGGTCCTATGGGCAGGTTTTTGAACAATGTGGATGATAAGGA AGCAAACGAAAGACCTTCCCTTAGAACGACATCAAGTGGGAAAGAGGCTTGTTCTCGAGCATGTCTCGACATTGGTAGGT TCTTTTATGAAAATGCACTTGCTTTCAATATTGCTAGGAGCCTCTCCTATTTTAATATGTGTAGATCAATTGGCAACTAT GGTAGAGATCTTATACCCCCAAGTATGCATGAGCTTAGAACATGAATTTTGAAAGAGGAAGTACTTACTACTGAAAAATT TGTGAAGGAGGTTAAAATGACTTGGAAACAAAAAAGAGTTTCTATATTATCTGATGGTTGGTCGGATGCTAGAAATCGAG GTTTGATCAATTTTTTAGTCAACAATCCTCATGGAACTATTTTCTTGAGATCTGTTGATGCATCTGATAAAAAGAAAGAT GTAAATCTATTGTTTGAGATGCTTGACGAGATTGTTGAAGAAGTTGGGGAAGATCTTGTTGTTCAAGTGGTGACTGACAA TGCAAGTGCTTATAAGGCTGCTGGAGCAAAACTAATGGAGAAAAGAAAACACTTATTTTGGACTCCTTGTGCTGCTCATT GCACTGATTTGATCCTTGAGAAACTAGGAGAATTGCCACAACATAAAAGGGCTTTGGTGAAAGTAAAAAAAAATTAGCAA TTATGTGTATAATCACCCTTGGGTGTTGTTATTGATGAGAAAGCTTACCAAAAGGGATCTTGTTCGACATGCTGCAATAA GATTTGCTATTGCCTATCTGACGTTGGAGTGCATCTATAGACTAATGCAGCCTTTACAATCTATGTTTGTATCGGAGGAA TGGAACAATAGTTCATATGCAAAGAAACCGGATGGGAAAGAAGTAAAAAAGGTAGTCATGAAGGATAATCAGTTTTGGGC AGTTGTTGGGTATGTTCTTAAGTCTACACAACCCATAATGAAGGTGTTGAGATTAGTCGACTCTGAAAAGATACCCGCCA TGGGATTTATATATGGGGCTATGGACAAGGCAAAAGAGCAAATTGCTAAAAACTTAGGAGATGAAGAGAAAGACTACAAG GAGATTGGGGAGATCATTGATGAAAAATGGGATCTTTAGTTGCATCAACATTTACATGCTGCAACATACTACTTGAATCC AAGGATTTGATACTCCGATAATCCTTCCAACCATCCTGAGATCAAGCTTGGTTTGTACCATTGCATGAATAGGATGTTTA AGGACCCAAATGATCTAGAGAAGGCCGACCTCCAACTAGATGAATTTCGACAGAAGAAAGGGTTTTTTGGCCTTCGTCAA GCTCAAGCATCATACATGAAACGCAATCCCAGAAAGTAGAAACTATCTTATTAATTTTGACTAATAAAACAGTTTAGATT GTTTGGCTAATTATTTTCATCTCAATTTTAAATTCAGATGATTGGTGGTCCCAATTTGGAGATGGTACCCCAGAGTGGCT AGCTTTGCAGTTAGAGTTTTGAGTCTCACTTGTTCATCTTCGGGATGTGAACACAATTGGAGTACCCACGACCAAGTTCA TACAAAGAGAAGAAATCGCTTGACTGCACAAAAGATAAATTCCTTGGTCTACATCATGTTCAACAAGAAGCTAAAAGATT GACATTTGAAAAAAAAGGCACTTCAGCAAGATGAGGATCCCTTAATCATTGATAAGTTGCCATCTGATGATGAATGGATA GCTGGAAATGAAAATGAAGGCGAAACTCAAACGGAGGAAGCAATTGACAATCTTGACATTGATCTTTTTGAGGAT >DTA_3_15_Mno length=2467;Class=DNA transposons;Order=TIR;superfamily=hAT; AGTTTTAAAAAGCCCAAAATACCCAAGCCCTTACTAACTAAGAAAAAACCCTAATAACAAAAGAACAAGACCAACTAGCT TGCACAGCTGTATCTCTCCTCCTTCTTCGCACCTCTCCTTCACGTGTTCCTCTACTGCATCAACCAGAACCAGCTACGAG TTAGAAGAAAACAAAGCAAGCCGACCCTTCAAGTGGGGTATCTAATCTCTTCTCTTAACTTGTTTTTTCATTTTGTAGTT GCAGTGCACCGTGAACCATTTTTTGGGTTCAATGTGTGGTTTTTCTTTTCTTTTTTATTTAAGTTAGGATGAGACCTCCA CAAAATGCTAGCGGTGGTCGTAATGGGAAACGGGATCTGGCTTGAAAATATGGAAAAGAAGTTACATCGGAAAATGACAA AAGGACTTATGTTTACGTCCAATGTGTGTTTTGCAATCAAATTATTAAAGGAGGTGTTAAGAGAATGAAAGAGTACCTTG CTTGCACTCATAAGAATGTAAAGCATTGTCCTAAGGTTCCTGATGATGTGAAGAAAGAAATTAATGACTCTATGAACAAG TGGGCTGCTAAAAAACAGTCAGCGCATCAGAATTTTGAAGAAATTGTGGATGTTGGCTCTTATTTTGGTGATGGATTTGT CGACTCTTGTCAGCCGCCGTAAGTGGTTAGTGATAGAGGAGTTAAAAGGTCCCATGGACAGATTTTTGAACAATGTGGAT GATAAGAAGCAAACCAAATACCTTCCCTTAGAAGAACATCAAGTGAGAAAGAGACTCGTTCTCGAGTATGTCTCGACATT GGTAGGTTCTTTTATGAAAATGCACTTGCTTTCAATATTGCTAGGAGCCCCTCCCTCCTATTTTAATGTGTAGATCAATT GGCAACTATGTTAGAGGTCTTGTACCCCCAAGAATGGATGAGCTTAGAATATGGATTTTGAAGGAGGAAGTACTTACCAC TTAAAAATTTGTGGAGGAGGTTAAAATGACTTGGAAACAAACAAGAGTTTCTATTTTATCTTATGGCTGGTCGGATGCTA GAAATCGAGGTTTGATCAACTTTTTAGTCAACAATCCTCATGGAACTATTTGTTTGAGATCTGTTGATGCCTTTGATAAA AAGAAAGATGCAAATCTGTTGTTTGAGATACTTGACAAGATTGTTGAAGAAGTTGGGGAAGATCTTGTTGTTCAAGTTGT GACTGACAACACAAGTGCTTATAAGGTTGGAGTCAAACTAATGGAGAAAAGAAAACACTTATTTTGGACTCCTTGTGATG CTCATTGCATTGATTTGATCCTTGAGAAACTGGGAGAATTACCACAACATAAAAGGGCTTTGGTGAAAGCGGAAAAAATA AGCAATCATAGACGTTGTCAATGATGAGAAAGTTCACCAAAAGGGATCGTGTTCGACCTACTACAACAAGATTTGCTACT GCCTATCTGACTTTGGAGTGCATCTATAGACTTTGGAGTGCATCTATGTTTGTATCAGAGGAATGGAACAAAAGTTCATA TGCAAAGAAACCGGATGGGAAAGAAGTGAAAAAGATAGTCATGAAGGATAATCAGTTTTGGGCTGTTGTTGGCTATGTTC TTAAGTCTACACAACCCATAGTGAAGGTGTTGAGATTAGTCGACTCTGAAAAGACGTCCGCCATGGGATTTATATATAGG ACTATGGACAAGGAAAAAGAGGAAATTGCTAAAAACTTGGGAGGTGAAGAGAAAGACTACAAAGTGATTTGGGAGATCAT TGATGGAAAGTGGGATGTTCAATTACATCAACATTTACATGCCGCAACATACTACTTGAATCCATGGATTTGATACTCCG ATAATCCTTCCAACCATCCTGAGATCAAGCTTGGTTTGTACTATAGCATGAATAGGATGTTTAAATTGGCTGACAGTCAA GAATTTGTGGACAATGAGAGATTTAAATTGGTTGATGCTTCTCTTAGTAGTAACGATGATTGATGAGTTGGGAGATTAGG CTTTTAGAAGTGCATTATGAAGCTTATGATATTAGGATTTGATAAATATTTAGTCTTTTTTACGCTTCTAGTAGTGAAAT ATACTTCTCTTTATGTGGATGTTTTGTTAAATTTCTTGTTTTTAATGATTATTAAGTATGAATTTAGTTTTTGTTACTAT TATTTAAAAAAAAATAGGCATTTTTTGAGGTTTACGCATCAAAGCGCCTTGAGACTCGATTAGGCCTTTTAAAACCTTAT TCATGTCTATTTAAGGAAGAAACATTTTCAAGAAAAAGAAGTCTGACTTGAGAAAAAACCGAACTCGTTCAGATCATTAG GTAAATTTCCTTTTGAGTCTGATATCCCCAGGTCTAATTGGTCACTTGAAATTCCTATTGCTCATAGAAAAGGTGTTCGT ACATGTACCAAACATCCTCTCTCCAAATTTGTGTCTTATGAAAAGTTGTCATCACCGTTTCATGCTT >DTA_3_16_Mno length=2426;Class=DNA transposons;Order=TIR;superfamily=hAT; GTTCTTCGCGCCTCCTTCTTCGCAACTCCTTCGCCAAACGCCGTGCGCCTCCTCCTTCGCCGACTGCCGTGCGTCTCCTC CTCCTTCGCGCCACCTCCTCCTTCTTCTTCACAAGGTTCCTCTGCTCCTCTGCTCCAACCAGCCGCAGCCACACAAGTCT TCACAAGATATCTAATCTCTTGTTGGCTTTTTTTTTTTCATTTTGTAGTAGCAATGTAGCATTCTAGCAGAGTTTGACCG TGAATGACTTTTTGGGTTTAAACTTTAATGTTTCGTTTTTTTTTTTTTTAAAGTTAGGAATTAGGATGAGACCTCCACAA AATGCTAGCGGTAGTCGTAGTGGGAGACAGGATCCAACTTGGAAATATGAAAAAGAAATTACATCGGAAAATGACAAAAG GACTTATGTTTACCTCCAATGTGTGTTTTGCAATCAAATTATTAAAGGAGGTGTTAAGAGGATGAAAGAACACCTTGCTT GCACTCATAAGAATGTAAAGCATTGTCCTAAGGTTCCTGATGATGTGAAGAAAGAAATTAATGACTATATGAACAAGTGG GCTGCTGAAGAACAGTTAGCGCATCAGAAATTTTGAAGAAATGGTGGATGTTGGCTCTTATTATGGTGATGGATTTGTCG ACTCTTGTCAATCGCCGCGAGTGGTTAGTGATAGAGGAGTTAGAGGTCCCATGGATAGGTTTTTGAACAATGCGGATGAT AAGGAAGCAAACAAAAGACATTCCCTTAGAACGACATCAAGAGATAAAGAGGCTCGTTCTCGAGTATGTCTCGACATTGG TAGGTTATTTTATGAAAATGCACTTGCTTTCAATATTGCTAGAAGCCCCTCCTATTTTAATGTGTAGATCAATCGGCAAC TATGGTAGAGGTCTTGTACCCCTAAGTATGCATGAGCTTAGAACATGGATTTTGAAGGAGGAAGTACTTACCACTGAAAA ATTTGTGGAGGAGGTTAAAATGACTTGGAAACAAACAAGAGTTTCTATTTTATCTGATCGCTGGTCGGATGCTAGAAATC GAGTTTTGATCAACTTTTTAGTCAACAATCCTCATGGAACTATTTTCTTGAGATATGTTGATGCCTTTGATAAAAAGAAA GATGCAAATCTATTGTTTGAGATGCTTGACGAGATTGTTGAAGAAGTTGGGGAAGATCTTGTTGTTCAAGTTGTGACTGA CAATGCAAGTGCTTATAAGGCTGTTGTAGCAAAAGTAATGGTGAAAAGAAAACACTTATTTTGGACTCCTTGTGCTGCTC ATTGCATTGATTTGATCCTTGAGAAACTAGAAGAATTGCCACAACATAAAAGGGCTTTGGTGAAAGCAAAAAACATTAGC AATTATGTGTATAATCACCCTTGGGTGTTGTCATTGATGAGAAAGTTTACCAAAAGGGATCTTGTTCACCTACTACAACA AGATTTGCTACTGCCTATCTAACTTTGGAGTGCATTTATAGACTAATGCAGCCTCTACAATCTATGTTTGTATTGGAGGA ATGGAACAGCAGTTCATATGCAAAGAAATCGGATGGGAAAGAAGTGAAAAAGATAGTCATGAAGGATAATCAATTTTGGA CTGCTGTTGAGTATGTTCTTAAGTCTACACAACCCATAGTGAAGGTGTTGAGATTAGTCGACTCTGAAAAGATGCCCGCC ATGGAATTTATATATGGGGCTATGGACAAGGCAAAAGAGGAAATTGCTAAAAACTTGGGAGGTGAAGAGAAAGACGACAA GGAGATTTGGGAGATCATTGACGAAAAGTGGGATTTTCAGTTGCATCAACATTTACATGCCGCGGCATACTACTTGAATC CAAGGATTCGATACTCCGATAATCCTTCCAACTATCCTGAGATCAAGCTTGGTTGCATGAATAGGATGTTTAAGGACCCA AATGATCTAGAGAAGGCCGACCTCCAACTAGATGAATTTCGACAGAAGAATGGGTTTTTTAGCCTTCGTCAAGCTCAAGC ATCATACATGAAATGCAATCCTAGTAAGTAGAAACTATCTTATTAATTTTGACTAATTATTTTCATCTCAATTTTAAATT CAAATGATTGGTGGTCCCAATTTGGAGATGGTACCCTAGAGTTGGCTAGCTTTGCAGTTAGAGTTTTGAGTCTCACTTGT TCATCTTCGGGATGTGAACGCAATGAAAGTCCCCACAACCAAGTTCATACCAAGAGAAGAAATCGCTTGACTGCACAAAA GATAAATTCCTTGGTCTACATCATGTTCAACAAGAAGCTAAAAGATCGACATTTGAAAAAAAAAAGGCACTTCAGCAAGA TGAGGATCCCTTAATCATTGATGAGTTGCCATCTGATAATGAATGGATAGTTGGAAATGAAAATGAAGGTGAAATTCAAA CGGAAGAAGCAATTGACAATCTTGAC