>DTA_3N_1_Mno length=538;Class=DNA transposons;Order=MITE;superfamily=MITE; TAGGGGTGTAATTCGGCCGGGTAGGGTCGGGTTGAGCCGAAAAATTGAGCCGACCCGCTCAGTGCGGGTTGAGAAAATTT TAGGCCGCAACACTCTCTTAAGCCCACAAACCCGCAACCTGTCGGGTGACCTCGGGTAGGCTCGGGTTACTCGGGTTGGT GAAAACCAATTTTAATCTATGACTTCATACCTCTTTTAACAGTCCAAAAGCATAAAATCCATAAACAGTCCATAAGCATT AACATAACATCAAACATACTTCTTAACAGTCAATAAAGTCCAGAAATAAAATTAACAATACGTCAAATAAACAGTCCATA TAGAGATAGTCCAGCAAAATAGATTTAGGGATTTAGGGTTACACACCTAAATCGGGTCGGGTCGGGGCAAAGCGGGTTCA AAATGCCCGCCCCGCCCCCCAACCCGCACAGTGCGGGTTGGGACTATTTGAATCCGAATTTTAAAAAAAAAAAACCCTAC GCTTTCGGGTCGGGTCGGGGCGGGTTATTCGGGTTCGGGCTCATTTCTTACACCCCTA >DTA_3N_2_Mno length=680;Class=DNA transposons;Order=MITE;superfamily=MITE; TAGGGCTGTAAGAAATCACCCCGAACCCGACGAACCCGGCCGAGCCGAGCCGACCCTACTCGAAAATCACGGGTTTCTAA TTTTTTATTTAATTTTCAGTTTTAATTATGCCTAACCCGCACTGCGCGGGTAGGGGCGCGGGGTGGGGTTACATGAACCC GAGGTAACCCTACCCGGCCGAACATGTTCAAAGTAGGTAAAACAATGTCCAACACTTCAAATTCTTACTTTCATAAGTTT ATGGACTTTATGCTTTTAAACTGTTAACTTATTTATGTTTTGGATTCACGGTTTGTGTAAAAAATGCTTGTATGCCATAG TTGTTGAATTAGGACATTCTTTATTTATATTGGAAGTGTTTGATTTCAAAGTGAGTGTTTTAATTGTTCACCTTGCATTT AGACCCCCTCTTGAAGGAAAGACATGTTCTGTTTGATAATGATTTCTTCTGTAACAAGCACAGATTAATTGACTAAAAAT TGATTAAAATTGATGAAGTCATAGATTAAAATTGGTTTTCACCAACCCGAGTAACCCGACCCTACCCGAGGTCACCCGAA AGGTTGCGGGTTTGTAGACTTAAGAGAGTGTCACGGCCTAAAATTTTCTCAACCCGCACTGGTCGGGTAGGCTCAATTTT TCGGCTCAACCCTACCCTACCCGGCCGATTTACACCCCTA >DTA_3N_3_Mno length=865;Class=DNA transposons;Order=MITE;superfamily=MITE; TAGGGGTGTAAATCGGCCGGGTAGGGTAGGGTTGAGCCGAAAAATTGAGCCTACCCGACTAGTGCGGGTTGAGAAAATTT TGGGCCGCGACACTCTCTTAAGTCTACAAACCCGCAACCTTTCGGGTGACCTCGGGTAGGGTCGGGTTACTCGGGTTGGT GAAAACCAATTTTAATCTATGACTTCATCAATTTTAATCTAAGAGGCTCTTATATGCAAATAAATGATAAAATACTATTG TAGTAAATGAGCAATAAATGATATATGCAAATACTATTGTAGTAAATAATTACACAACAAAATTGCGGCATAATAAAATA TAAAGACTAATAACTCATATCACAATATGCATAAAGCAAGAGTGATCTCAAGGACCACATGATCACTTTTTAGTCAATTA ATCTGTGCTTGTTACATAAGAAATCATTATCAAACAGAACATGTTTTTCCTTCAATAGGGGGTCTAAATGCAAGGTGAAC AATTAAAACACTCACTTTGAAATCAAACACTTCCAATATAAATAAAGAATGTCCTAATTCAACAACTATGGCATACAAGC ATTTTTTACACAAATCGTGAATCCAAAACATAAATAAGTTAACAGTTTAAAAGCATAAAGTCCATAAACTTATGAAAGTA AGAATTTGAAGTGTTGAACATTGTTTTACCTACTTTGAACATGTTCGGCCGGGTAGGGTTACCTCGGGTTCATGTAACCC CACCCCGCGCCCCTACCCGCGCAGTGCGGGTTAGGTATAATTCAAACCGAAAATTAAATAAAAAATTAGAAACCCGTGAT TTTCGGGTAGGGTCGGCTCGGCTCGGCCGGGTTCGTCGGGTTCGGGGTGATTTCTTACAGCCCTA