>DTA_29_1_Mno length=2525;Class=DNA transposons;Order=TIR;superfamily=hAT; GAGTATACCTTCCAAACGGACCCTAAGTCACTTCTAGCAAAAACCCACTTGTCAATTTGGCTTGATTCTTGCTTCAGCTT CAGATATTTATGTTCTTTATTTATTTTGTTCATGTATTTTTTTTAATCTTCATTTGAATGCTCTATTTTCGTTTATACGA TTTTGTTGACTTTGTATACATGTTCTTGAATTATTTGCATAACAATTCAATGTTGGCTTGATTTATTTTGTTATATTGTT CTATTTTTATCGTTTTTAATTGATTGTATTGGTTTTGAGCACAGATTCTACAATGTTGGCATTCAAATTTCAGTGTTGGG GTTTAAGAATTTGTTGAACTTTTGACTAGTTGAAGAAAATGGTGCGAGGAAGAGATGCCTGTTGGGAACATTGCGTCCTT GTTGATGCAAACAGACAGAAGGTTAGATGTAACTATTGTCAGCGGGAATTCAGCGGTGGCGTATATAGGATGAAGTTTCA CTTAGCTCAAATAAAGAACAAAGACATAGTCCCTTGCACAGAAGTCCCAAATGAAGTCTGTGAACGAATTCGGAGCATAT TAAGTGCTCCCAAGAATCAGAAAACTACCAAGAAACCAAAGGTGGATCAGGCAGCAGCCGTGGTCAATGATCGACATAAT AGCTCTTCTGCTAGCGGCGGCTTCCAACCTAATGACGATGGATCTACCAGTCAGAATGGAAGCGCCTGCCCATCTTTGTT GTTTCCAAACCCTTCGCCAAATAGACAACCGGAGGTGGAAGAAGCTCAGAGGCAAAAACAAGATAATGCTGATAAAAGAA TTGCTGTTTTTTTCTTCCACAATTGTGTCCCTTTTAGTGCTGCTAAATCCATGTATTACCAAGAAATGGTGGATGCTATA GCAGAATGTGGGGTGGGCTATAGAGCCCCCAGTTATGAGAAGCTAAGATCTTCACCGTTGGACAAAGTAAAAGTCGAAAT ACATGATTCCTATAGGAAATATAGAGATGAGTGGAGAGAAACTGGTTGTACTATCTTATGTGATAGTTGGTCTGACGGTA GTAGGACCAAATCACTTGTGGTGTTCTCGGTTACATGCCCAAAGGGGGCGTTATTTCTGAAGTCAGTTGATGTCTCCGCT AACAAAGACGATGCTAATTACTTGTTCGAGTTGCTCGAGTCTGTTGTCTTGGAGGTTGGTGTAGAAAATGTTGTTCAGGT CATAACTGATGTTGCAGCCAGTTATATTTACGCGGGACGGCTTCTCATGGCAAAGTACAATTCTTTGTTCTGGTCTCCTT GCGCGTCTTGTTGTATCGATAAGATTTTGGAGGATCTTGGTAACCTAGAGTGGGTGAACACAGTCCTGGAAGAGGCAAAG ACCATGATAAGGTACATTTATAGCCATTCTTGGACTTTGAATATGATGAGAAAGTTCACCGGCGGAAGGGAACTAATGAG GCCAAGAATCAGTAGATATGTCACTAATTTCCTCTCCTTGAGGTCTATCGTGATTCAGGAAGAAAATTTAAAACACATGT TATCTCATACAGATTGGTTGTCATCCGTGCACAGTAGACGTCCTGAGGCTCAAGCCATCAAGTCCTTGTTGTATTTGGAT AGATTTTGGAAGCACGCACAGGAAGCTGTTAGAATTTCCGAACCATTTGTTAAAATCCTGAGAATTGTTGATGGGGACAT GCCAGCCATGGGCTATATGTATGAAAGCATAGAGAGGGCCAAGGTTGGCATAAAGGCCTACTATAAAGGAGTTGAAGAGA AGTATATGCCGGTTTGGGATATGATCGAGCGGAGATGGAACATGCAGCTCCACTCATCCTTGCACGCAGCTGCAGCATTC CTAAATCCTTCGATATCTTACAACGCAAGTTTTAAGATGGATTTGAGATTGAGGAATGGGTTCCAAGAAGCAATGTTGAA AATGGCTACCACAGACAATGATAAGACGGAAATAACCAAGGAACTTCCGAAGTACATTAATGCACTAGGTGCTCTTGGGA CAGATTTCGCAATTATGGGAAGGACATTGAACGCCCCAGGTATGAGGCTGGATGGGAGAAGGAAATACTTTTCCCATTCT CTTTTCATATATGATAAGTAAACACACCCATGTGATTGGAAGAAAGGATTATTTGTCCTGCTCAGCCGACAAATAGGCTA CCCCCCTAGGCTTCTTTTTCTCAATTGGATTAAACCACAAAATTTCTTATATAGCTTTGTTAAGTTTTCAGCCAGTAATT ATGTAGGACTTATACACAAGATCGTTTTAGTAGTTAACTTATAATGATTTCTATTCCTAAAGTTAGTAAACATTAGAAAG TAAAAGAAAGGGAATTAGGTTGTTTCTATTCCAAATTTCTATTAAGCAAATAAATGATAATAGAAGCGGAATCAAGCATC TCTTTTCCATTCTTTTCATTTCCCAAACTTTTCACTTTCCATTACGTCCCTTTACACATTAGTAAACACGCCTTTAATAG AGCTGATAGTTGACATTACACAAGTTGTGTAATCACTCATCTCAT